Sunday, March 31, 2019
Impact of Internationalisation of Business Markets
Impact of world(prenominal)isation of Business MarketsThis base aims to analyse and discuss the externalisation of business and orbiculate grocerying issues. It besides analyses the play of global marketing environs on the marketing activities of the planetary house. In coordinate to prepargon this report, at that place has been a use of several(a) schoolman textbooks and journals.Over the past thirty years, remoteisation of the firm has been the most a great deal researched topics in international marketing (Fletcher 2001). It has been used to describe the outward ride or increasing elaboration in a firms or larger groupings international trading operations (Fillis 2000). In general, Internationalisation refers to the increasing importance of international trades, international treaties, international relations, all toldiances, etc.Firms under egress international operations due(p) to various reasons (Lam and White 1999). Some internationalise due to the fact t hat their competitors or customers rush been globalised (Ohmae, 1990), whereas others atomic number 18 pushed by the idea of multinationalism as a symbolization of success and progress (Gerlinger et al. 1989).The firms use a gradationwise approach along with an organisational continuum, in order to develop the international operations. The Uppsala School views internationalisation as having four stages while it has also been formled with five and six. Although the number of incremental stairs may differ, thither is general agreement that with each subsequent step comes increasing involvement in international operations. However, due to increasing globalisation, chaotic market conditions and technology effects, it is believed that much(prenominal) stepwise advancement is not primarily exhibited in SMEs and that alternative bewilderling of microenterprise behaviour is needed in order to account for emerging modes of behaviour (Fillis 2000).Definition of InternationalisationT here be many possible definitions of Internationalisation, some referring to the whole economy of the home or internationalising, country, some referring to specific sectors of the economy, and some referring to MNEs themselves (Kumar, N 1998).Calof and Beamish (1995 116) denotes Internationalisation as the attend of adapting firms operations (st stridegy, structure, resources, etc) to international environments.Whereas, Welch and Luostarinen (1988), Rao and Naidu (1992), Easton and Li (1993) and Johanson and Vahlne (1993) has defined internationalisation as a serve well by which firms increase their involvement in international business activities.From the above-proposed definitions, it can be reason out that Internationalisation is a process in which the firm bit by bit increases its international involvement.Complexity and challenges in InternationalisationInternationalisation is a process which is precise complex and challenging by nature. There have been various factors w hich have made internationalisation as a complex process. The most important factors are doubt in formats, formula and markets, the high degree of operational flexibility required and in that location need to be the high rate of formula innovation in order to get a success in internationalisation (Dawson, J. 2003). perplexity in Formats, Formula and MarketsAs being an international market for the internationalising firm, it is very uncertain. The firm faces huge competition from the local markets. These all factors make internationalising for the firm very challenging.High degree of operational flexibility requiredIn order to perform a successful internationalisation process, there necessitate to be a high degree of operational flexibility, which will supply an advantage to the internationalising firm everyplace the local firms.Need of high rate of formula innovationIn order to gain an advantage over the local firms, the internationalising firm has to be very active in basis o f innovation. As the competition will be high for the internationalising firm there needs to be a rapid innovation of the formula.Uppsala Internationalization presentThe Uppsala Internationalization Model was originally developed by Johanson and Vahlne (1977, 1990). This mannequin, also cognize as the incremental theory of internationalisation, shows that enterprises gradually increase their international involvement according to the development of their knowledge about foreign markets and operations. Camuffo et al. (2007) enhanced this personate by adding technological knowledge and customer-supplier interaction as important determinants of the process, stating that cross-border amplification into a neighbouring country might shorten the time required to garner knowledge and to control the facility in the target country (Reiner, G. 2008).The Uppsala model has described the internationalisation of a firm as a process of experiential learning and incremental commitments which l ead to an evolutionary development in a foreign market. Johanson and Vahlne formulated this approach in 1977, referring to empirical observations on Swedish manufacturing firms from their studies at the international business department of Uppsala University. One of the grassroots assumptions of the model is that the lack of knowledge is an important obstacle to the development of international operations (Johanson Vahlne, 1977 23). Hence, the Uppsala model has dealt fundamentally with knowledge acquisition and learning. It has been observed that the absence seizure of market-specific knowledge has forced the many manufacturing firms to develop their international operations in small steps, undertaking incremental commitment finales and moving at the number genius to psychically close countries in order to reduce the market uncertainty (Johanson Vahlne, 1977 24).Uppsala model is based on four core concepts market commitment, market knowledge, current activities and commitment decisions. These four concepts are then divided into province aspects and counterchange aspects. The two state aspects are market commitment, which is the resources committed to foreign markets, and market knowledge, which is the knowledge about foreign markets and operations possessed by the firm at a given time. The two change aspects are current activities and commitment decisions. The latter are the decisions to commit resources to foreign operations (Johanson Vahlne, 1990).Drawback of Uppsala Internationalisation modelThe Uppsala model has been criticised for being partial and deterministic (Hollensen, S. 2007).The frontmost criticism is based on the fact that Johanson and Vahlne 1977 rely on sole(prenominal) one construct- experiential knowledge as one of several constructs, including the decision making process of the firms charge. On the other hand, the internationalisation process model does deal with how other factors are handled in the process (Blomstermo, A. 2003). The criticism that the model is deterministic has to do with the incremental development of experiential knowledge and its presentment in the visible stage model. Researchers provide empirical evidence that shows that firms do not always start with occasional merchandises and end up with a production company abroad (Newbould, Buckley and Thurwel 1978).It has also been argued that the model does not take into account interdependencies between different country markets (Johanson and Mattson, 1986)Advantages of Uppsala Internationalisation model afterwards analysing the Uppsala Internationalisation model it was found that there have been very a few(prenominal) advantages. The only advantage associated with this model is that it explains the internationalisation process. In comparison to all the other models of internationalisation this has been highly criticised (Madsen, K. 1991).Macro-environment ForcesWhether its an international banking organisation, a university or a manufactur er, no organisation exists within a vacuum. It is very likely competitors, to be subject to international, national and local control, obliged to comply with national or European pollution fluctuations in the fortunes of the global economy (Brooks, I. 2004).Factors that make a companys or products development but that are outside of the companys control. For example, the macro environment could include competitors, changes in interest rates, changes in cultural tastes, or brass regulations etc (Hill, C. 2009).Macro- environmental forces influencing Internationalisation processThe various outside influence on a firms decision to go international are as follows export AgentsGovernmentsChamber of commerceBanks etc.Unsolicited international orders are one major factors influence the firm to begin exporting. In United States, such orders have been found to account for more than half of all cases of export initiation by small and medium-sized firms. Another major influencing agent may a ctually be a competitor. Just as firms respond to competitory pressures from other companies, statements by executives from other competing firms may serve as change agents (Czinkota, M. 2007).Export AgentsExport agents as well as export management firms generally qualify as experts in global marketing. They are already dealing internationally with other exportable products, have overseas contacts and are set up to handle other exportable products, have overseas contacts and are set up to handle other exportable products. numerous of these trade intermediaries approach likely exporters directly if they think that their product have potential markets overseas (Hollensen, S. 2007).GovernmentsIn nearly all countries governments try to induct international business through providing global marketing expertise (export tending programmes). For example, government stimulation measures can have a positive influence not only in terms of any direct financial effects that they may have, but also in relation to the planning of information (Welfens, P. 2001).Chambers of commerceChambers of commerce and similar export production organizations are interested in stimulating international business, some(prenominal) exports and imports. These organizations seek to motivate individual companies to get involved in global marketing and provide incentives for them to do so on. These incentives include putting the prospective exporter or importer in touch with overseas business, providing overseas market information, and referring the prospective exporter or importer to financial institutions capable of financing global marketing action mechanism (Hollensen, S. 2007)..BanksBanks and other financial institutions are often instrumental in get companies to internationalize. They alert their domestic clients to international opportunities and help them to capitalize on these opportunities. Of course, they construction forward to their wait ons being used more extensively as domestic clients expand internationally (Czinkota, M. 2007).Common Customer needsIn general, calibration is less likely with services that with goods. Within services, the potential for standardization is greater the less the supplier is involved in the delivery because this increases the finis to which customer needs are likely to have more features in common.Scale EconomiesThese are driven by the opportunity to spread located costs. With services, such economies are more likely to come from standardised processes than from a physical concentration of activities (Blythe, J. 2005).Competition DriversThese often occur because the service provider finds it necessary to go international in order to protest its impersonate in the domestic market, especially if costs can be lowered. If the service providers do not take this step, then there is an increased guess that firms in the international market may use that market as a base from which to internationalise their operations (Toy ne, B. 1989).Information Technology driversThe might to centralise information hubs on a global basis is a motive because it strengthens the firms competitive position. For example Rupert Murdochs involvement in satellite TV in order to monopolise sports coverage (Brown, L. 2004).Apart from the above-mentioned drivers, there are some more drivers of internationalisation such as whirling in information and communications systems, globalisation of financial markets and also improvements in business travel (Blythe, J. 2005).ConclusionFrom the above discussion and findings, it can be concluded that Internationalisation is a process in which the firm gradually increases its international involvement. It has been also found that the internationalisation is very complex by nature. Various models of internationalisation have been proposed till date, out of which the most noteworthy model is Uppsala approach model of internationalisation. However, it was found that there have been various drawbacks in this model such as, being partial and deterministic, not interpreted into account interdependencies between different country markets etc.From the discussion of the influence of various macro environmental forces on internationalisation, it can be concluded that there is an increasing number of influence on the firms to go for industrialisation.
Critical Discourse Analysis On Imagine English Language Essay
Critical Discourse Analysis On figure slope Language EssayA song is a relatively little musical composition for the human voice (possibly accompanied by separate musical instruments), which features contrives (lyrics). However, when we ar talking about a song, we stomach not ignore the singer who is going to sing the song and sack it popular. Then, when it comes to the singer, we may remember a name c each(prenominal)ed, put-on Lennon. Almost all people around the world know who John Lennon is and also his band, The Beatles. He already became a pop legend in music history. He had written some hits that are sung again and again until now. some(prenominal) of his songs were about peace and war. believe, which was released in 19712, is also one of his popular hits with that topic. With a social theme and a strong nitty-gritty, this song has touched legion(predicate) people. Therefore, it means the words that were chosen for this song are effective and short delivered the depicted object, so it stern touch the listeners emotion.The purpose of this move is to do a critical discourse analysis on Imagine by John Lennon using several theories. The first theory that is used in this essay is critical linguistics by Roger Fowler, Robert Hodge, Gunther Kress, and Tony Trew. Critical linguistics teachs language as a social practice and through which a group can empower and spread its political orientation (Eriyanto, 2005)3. This theory analyzes language through two elements, which are vocabularies and grammar. This theory believes that a discourse can convey its ideology based on the choices of vocabularies and also the use of the grammar. Choices of vocabularies can cause fewer effects in a discourse such as work out a classification, limited view, battle of discourse, and marginalization. On the early(a) hands, there are several models in the grammar. Therefore, a discourse would never be neutral because the writer chooses e really single word to variant the meaning that he/she demands to tell. A discourse always conveys a certain idea or ideology to the audience.Next, the moment theory is the theory that was introduced by Sara mill around. She used to see a discourse from the feminist perspective, how a woman is being characterization in a discourse. Although, she was known more for her womans representation in a discourse, her theory approach can be applied in other fields. If critical linguistics tends to analyze a discourse from the language aspects and how it influenced the audience, Sara Mills sees the position of the actors who perform in a discourse. At first, she compares the position surrounded by the subject and the object. Then, she also sees the position of the writer and the reader.Although with its simplicity and clarity4, Imagine is rich of meaning because anybody can cave in different interpretation of it. The kernel of this song is that lets create a world which is peace and no war. This message is repeated again and again in the last part of this stanza. In the first stanza, it is said infer all the people, living for today, in the second stanza imagine all the people, living life in peace, while in the third stanza, it is said imagine all the people, sharing all the world. The message even becomes stronger with the chorus part, where it is stated the world will be as one. Those clauses form a message to the audience which is to make a give way world. Furthermore, the repetition of the message, although in different words, but still take a shit the comparable meaning, makes the audience get this message easier and then remember it better.The word Imagine itself, besides being used for the title, it also repeated several time in the song.Imagine as a verb means form a calculate of in the mind conceive of of something as probable (Hornby, Cowie, A.C, 1974). Therefore, imagine happens in the first place the reality. Imagine itself has several synonyms. Then, why the wri ter chooses imagine in the end. essenceImagine to have a externalize or idea of something in your mind.1.ImagineTo think about something and form a jut or idea in your mind about it.2.Visualize / VisualiseTo form a very fire picture of something or someone in your mind, especially in order to help you prepare to do something or help you to remember something clearly.3.PictureTo have a clear picture of something or someone in your mind, especially because you are trying to imagine what it is like to do something or what someone looks like.Imagine to imagine something you want to do or want to happen1.Fantasize / FantasiseTo think about something that you would like to do or that you would like to happen, especially when it is very unlikely that you will do it or that it will happen.2.DaydreamTo guide a short time imagining something pleasant, so that you forget where you are and what you are doing, especially when you are bored.3.DreamTo imagine something pleasant that you woul d like to or to happen, especially if it is possible that it might happen.Table 1 Words associate to imagine according to Longman Language Activator, 2006Every synonyms of the word imagine have the same meaning which is to think about something and form picture in someones mind. Then, why imagine is chosen? Because each words carries certain meaning, champion and also describes different condition, although they all have similar meaning. Visualize and picture describe about thought process something that is already clear. However, we can not spirit any clarity sense from the imagine word. As a result, the word imagine is appropriate with the context because the condition, which was peace, that the writer wanted was not clear yet and even until we hear it now, this situation remains not clear. Although it sounds bare(a) and easy to say, peace is something complicated and it depends on who is saying it. Peace is an get up condition, we cannot really define this condition with w ords and every body would have different perseption about this.Furthermore, fantasize and daydream are also not appropriate for the song context. Both fantasize and daydream are thinking about something which is out of reach and not likely to happen, or in other words, the possibility to that event to happen
Saturday, March 30, 2019
America and Multilateralism: A History
the States and Multilateralism A accountPerhaps it is safe to surmise from the rattling beginning t don in that location does non start to be a rustic in the manhood that is non affected or has non been affected in virtuoso fashion or the early(a)(a) by the linked States of the States. Short of this, in that location nigh certainly does not remain in existence a country, mickle or society which has no k straight offledge, however limited, of the United States of the States. No wizard day passes without the the Statesn forcefulness being addressed or diagnosed in integrity capacity or the new(prenominal) by the orbicular media. oer time, provided in rangeicular, in more than(prenominal) recent times, no other countrys governmental, domestic, stinting defence or capabilities and abilities substantiate been more studied or discussed than the extent at which the States has been. In factual fact, it is safe to surmise that actu e precise last(predicate)y few political breaks today go down up very much(prenominal) strong and diverse responses as the role of the United States of the States in its attempt to re-shape globe affairs.1 The recent terrorist attack on the States of grave consequences, its reaction to it and the wars in Afghanistan as s puff up(p) up as Iraq have intensified the debate about the nature and prospects of the Statesn super military force. there remains a schoolhouse of thought that slip aways to celebrate the United States achievements in proclaiming as puff up as bringing liberty, democracy and succeedity to all(prenominal) corner of the instauration. Others are more inclined towards condem people of the Statess pursuit of hegemonic view and its attempt to impose a single frugal system and a narrow set of moral belief on other nations around the world. Whichever school of thought one belongs to re the Statess performance on the world(prenominal) podium, al almost have arrived at the conclus ion that the storey of the twenty-first century result be mulish to a large extent by the mood the Statesn business leader is used, and by the way in which other major political players on the worldwide front react to it. The nation has often been referred to as an imperial, an empire or hegemony. Most people exempt continue to perceive the States as that democratic land of roses where eachthing bay window happen. Some s work believe in, especi wholey those outside the shores of the country and s education to one day be admitted into the great country, what they call the the Statesn Dream. It is sup reachly a country where anything is possible. Often times however, the States is no overnight beheld with rose tinted spectacles. Given its recent history world over, this is hardly a surprise of any signifi domiciliatece. The word which billper obtains to mind when the States, that great nation is on a lower floor discussion as it constantly is for diverse reasons, is heg emony. What, it might be useful to enquire at this juncture, is hegemony? In lay mans terms, hegemony, succinctly put, is leadership by predominance ( about might even sound out aggression) of smaller and weaker states or nations by natur associate bigger nations in an labour to achieve world domination. Does the States therefore stand rightly accuse of attempting to dominate the world through its c erstwhileptualisation of global politics, foreign policies and fortify forces, or at least(prenominal) to dominate those nations which are considered smaller and weaker? It is customary knowledge that while some countries practice communism or neighborlyism, the States was and remains a capitalist country where the motto right aft(prenominal)ward In God We Trust is a universally accepted but unspoken survival of the fittest. In the introductory words of G. throne Ikenberry in his rule book the States Unrivalled, The pr-eminence of the Statesn forcefulness today is rare in mod ern history. No other great cater has enjoyed much(prenominal) formidable advantages in military, economic, technological, cultural or political capabilities. We live in a one-super force out world, and there is no serious competition in sight2These words fastly bring to mind perchance the most polemical wars of all times and the Statess gargantuan persona or one might even dare say vociferous single minded orchestration of the very(prenominal), the Iraqi invasion (and on-going war bank date) in 2003. It is cost reminiscing at this juncture how the world watched and waited with bated breathing spell while the United Nations deliberated on whether or not the United States should be given the authorisation to invade Iraq based on its reports about the so-called axis of evil and the weapons of mass destruction they supposedly had in the making which it further claimed posed un-foretold threats to the foreign world. It is yet another capitulum in favour of the melodic phrase that America is fast becoming or therefore has all but attained the status of an hegemonic state that President George W. pubic hair announced to the world that opineless(prenominal) of the UNs decision and that of its Member States, America result forge ahead in war against Iraq and Afghanistan, alone if they had to. In his exact words, when it stupefys to our pledge, we really do not need anyones allowance3 It was later argued that it would appear that even the United Nations, a so-called world moderator and outside(a) emblem of peace, is nothing but yet another motherfucker in Americas already brimming tool box. Although at the time, this announcement from the Bush Administration sounded as arrogant and above the rectitude as it really was, there were many a(prenominal) who felt America would be justified in its decision in the wake of the September 11 attack. September 11 2001 (here afterward referred to as 9/11) brought about the tour point in history, inte rnational law and the use of force against terrorism. The words of an American man considered very patriotic so comes to mind at this polemic stance of George W. Bush re brushing off the worlds opinion and/approval to its use of force in the name of battle terrorism. The man, none other than Richard Holbrooke, former United States ambassador to the United Nations, who erstwhile stated after careful observation, one should imagine, that the Bush administration threatens to sack up a radical break with 55 years of a nonpartizan tradition that sought international agreements and regimes of benefit to us4 Many years, issue of lives both civilian and military, reports of horrible treatments meted out to prisoners of war (PWO) by the American soldiers against every rule of Humanitarian Law and the Geneva Convention, Americas refusal to withdraw its troops even after the fall of Saddam ibn Talal Hussein (its greatest enemy) the question on everyones lips is whether the war was inde ed for all the altruistic reasons quoted by America in its rather fabricated reports or for more reasons dummy upr to home. The question can even be posed all the way bet on to Operation Desert Storm in the same Iraq in 1993. Did America invade Iraq on both occasion for economic gain and ultimately to place itself as the worlds super power. Although it appears now to the world that the Bush administration is the one obligated for dramatically drawing America away from multilateralism, a look back into the Clinton administration go out confirm that this is not remotely true. Under the Clinton administration, America n each waited for the United Nations approval/authorisation onwards deploying the North Atlantic Treaty Operation (NATO) to Serbia in 1999 nor prior to its turkey attack on Iraq in 1998. There were withal other Conventions, Acts and Treaties America rather conspicuously refrained from signing or ratifying much(prenominal)(prenominal) as the forbiddance of furthe r use of Land Mines (the Ottawa Convention of 1997). The difference whitethornhap would be where the Clinton administration adopted diplomacy in its delivery of much(prenominal) unilateral decisions the Bush administration simply forges ahead with no regard for the worlds opinion, approval or in most cases disapproval.In the era immediately after the World war (II), Americas strength was not yet viewed during the war with the deployment of its arm forces, which later make an alliance with the United Kingdom amongst others (the allied forces) but also after the war in its attempt to build Germany as advantageously as other war torn countries in the war aftermath. In this, America had strategised and was apparently successful in ensuring that the world did not revert to its close regional dealings of the 1930s prior to the war. The founding of the United Nations on 24 October 1945 also saw to it that the beginning of what is now cognise as globalisation was established. A p ost war era of multilateral sheath and significance was thus built around economic and certification agreements such as the Bretton Woods Agreement on monetary as salutary as mickle relations among nations. The American-led NATO security pact followed much later. This international erect which came into existence after the war (World War II) was effectively one which was multilateral in character. A more open system of trade and investments began to emerge, largely encouraged by America. Economic and security matters as intumesce as political relations became indistinguishable and indivisible among nations in what is best described as an open world market or globalisation. This is explicit in the General Agreement on Tariffs and Trade (GATT) as well as the Bretton Woods agreement earlier mentioned. An alliance tie emerged surrounded by the United States and the Great Britain in particular and the European continent in usual in a scenario one could simply put in lay mans ter ms rub my back and I will rub yours. Americas economic as well as security assistance to the Asian region is also worth mentioning. America ensured and continues so to do, that weaker and smaller states are afforded security assistance, protection and granted access to its markets, technology and country in general. In the wake of Americas Green Card Lottery scheme, the support and admiration of other smaller states for which the scheme was intended and who continues to benefit from the same was firmly secured. In a similar vein after the world war, citizens of many nations flocked in their thousands to America from world over and started life over again after the war. In what is not unlike the stone age trade by barter arrangement, the participating states in turn continue to ensure that political stability is maintained in their relationship with the United States, making operational to America their diplomatic, economic and logistical support in return. For instance, America has breeding causa in Saudi Arabia and Kuwait, perhaps as a pertinacious result of Operation Desert Storm.Going back in history however, it remains indelible that there were 5 world super powers including America itself. How then can Ikenberry infer that America has no competition in sight in its steady climb to the top in the international hemisphere? Who were the other four super powers and what became of them? The five major contenders when the United Nations was founded in 1945 were Russia, Great Britain, China, and France. It is accurate to say that the cold war put paid to Russias contention with America. The Great Britain, as exhibited more deep under the Tony Blair administration is more or less a lap-dog to Americans policies and remains a rather very friendly ally than a potential contender. Yet it will be nothing un sensitives of fallacious argument to say that America has no contender or is without competition in one form or the other. Worth recall as well is Germany and Frances initial reluctance as well as refusal to throw their weight behind the Iraqi invasion in 2003. Americas hegemonic state is therefore not without move out exceptions as well as take exceptionrs, it is however the multifaceted character of Americas power that makes the country so far reaching, daunting, provocative and formidable to less weaponed and smaller countries. The collapse of the Soviet trade union in the Cold War saw an acute decline in rival ideologies and even tighter alliances organize between the United States and other regions. Following the Cold War, America keep to grow from strength to strength. In the 1990s its economy was commendably and successfully restructured. excessively growing in meaningful progression alongside its economy is its fortify forces and global recognition as a state to reckon with. By the turn of the millennium, Americas economic and military fruit had deposit a seemingly insurmountable gulf between itself and other major players in world politics. While the late 90s saw Japans economy grow by 9 per cent, the European Union solely by 15 per cent, American economy grew by a significant 27 per cent, nearly doubling and tripling that of the other regions.5 This did not go unnoticed by the rest of the world. In fact literally doffing his hat to the United States in a speech in Paris (1999), the French Foreign Minister, Hubert Vedrine, observed that the growth witnessed by the world in America is not comparable in terms of power and influence to anything known in modern history6Americas devotion to its armed forces can by no means be ignored. America boasts an forces that is better equipped and out numbers the armed troops of well over 14 countries put together. There are training grounds for the United States army in well over 40 locations world wide. This automatically means that when another weaker or slightly less advantageous state envisages itself in trouble, the first point of call for protectio n and assistance, when and if infallible is the United States of America. In its usual confidential, bordering on arrogant manner Americas theme Security Strategy declared to the world that their forces will be strong enough to dissuade potential adversaries/ ambitious challengers from act a military build-up in hopes of surpassing, or even remotely equalling, the power of the United States.7 It is not impossible or even unthinkable for America to utilise its military capacity to impose its policies on other states in unalike regions of the world. It has been observed already that America spends on its armed forces more than the next fourteen countries feature and that the U.S. military expenditures will shortly be equal to the rest of the world combined.8 Another scholar of repute, Paul Kennedy, also surmised that it is already the case that all the other navies in the world combined could not dent American maritime supremacy.9 Still on the issue of security, expressing his own opinion and an opinion apparently shared by many others world over, Barry Possen has suggested that the United States command of the sea, space, and air forces is the key military enabler of the U.S. global power position.10 Assuming its economic growth remains as healthy as it has been since the 90s, the c erstntration of world military power may continue for several decades yet. Even at the current level of U.S. capabilities, it is the general view that the United States can shoulder the burden of maintaining global security without much help from Europe or the rest of the world for that matter.11It begins to appear obvious that perhaps Americas initial support for multilateralism in international trade and globalisation was borne of a grander strategic move to bring home the bacon and retain more power while legitimately promoting international corporate trust of one state on the other, one region on others for support, growth and assistance. A quick glimpse at major historic al turning points such as 1919, the end of World War II in 1945 and the period immediately after the Cold War all but confirms this logic. It would appear that America promoted multilateralism in such a strategic way so as to signal restraint and commitment from other states.12 This precipitated the encyclopedism of support, if not actual trust, acquiescence and cooperation of other weaker states. But surely when one country is placed so much higher than others in the case of all animals are equal but some more than others, there naturally arises the problem of balance of power or even equality before the law. What the majority of member states may attempt with the United Nations and come out facing adverse repercussions for is the same thing the United States will not notwithstanding attempt but carry out and come out smelling of roses. For the sake of this discussion, should one be given to a flight of run into however fleetingly and imagine or a import that a member state su ch as Ghana or Nigeria threatens the use of force against Cameroon and declares to the world that the same will be established whether or not the United Nations and indeed the world approves of its actions. At the very least, economic sanctions will immediately be placed on such a country. However in the name and under the umbrella of 9/11 it would appear that America is permitted to do and undo whatever catches its fancy and of course promotes its economic as well as military growth. How else can one begin to explain the issue of thousands held prisoner at the US military operated prison and indeed a recreation of Camp Delta, Guantanamo Bay, for years with neither charges nor trial in the name of fighting terrorism? America claims not to have jurisdiction in Cuba to try these prisoners yet it has the power and the authority to imprison them in Guantanamo Bay. What, one is right to ask, happened to the universal (at least in democratic states) writ of habeas corpus? Another example of Americas marked shift from multilateralism to unilateralism and establishing itself as a super power above the rest of the world is again glimpsed shortly after the controversial invasion of Iraq in 2003, when America was quick to submit allegations against North Korea as well as Iran for also becoming threats to the international community as they were manufacturing nuclear weapons. In an ironical twist however, in 1998, Japan, perhaps once one of Americas closest allies, was reportly furious with America when its officials unilaterally decided that funding for North Korean Nuclear reactors was to continue despite Japans complaints that North Korea was firing missile over its territory.13What then can possibly put an end to Americas domination of the international stage and its rise towards a super power of hegemonic characteristics? It has been established that the two most important factors in the growth of any nation its economy and defence, remain the two areas where Americ a continues to excel and prosper construeing it even more of a force to reckon with by other nations of the world. Is it then any wonder that many are of the school of thought that it is only a matter of time before America seeks to completely dominate the world and by so doing, simply mob out weaker states of the world. It is enough to alert the world that more than any other administration before it, the Bush administration is significantly departing from materialism curiously on agreements dealing with arms control and proliferation. Multilateralism, as Ikenberrys book posed the debate, does indeed seem to be on the decline in Americas policy and political stance. It has become to America a selective game where multilateralism is embraced when it adds to the muscles in its already bulky biceps and unilateralism at every other turn. As America continues to systematically depart from multilateralism and promote more unilateralism in its foreign policies and decisions on security affairs affecting not only its boundaries (assuming such a word as boundary exists in the American dictionary) but also spread ashore to other nations of the world, the world may very well be moving rather apace towards the final unravelling of America as a hegemonic nation. What and who in the world can then possibly challenge Americas hegemony? Surely it would clear a large scale war or a significant global economic crisis to challenge or even come close to threatening Americas hegemony. While this might be very well put and even precise in theory, surely either option will definitely have grave repercussions on the international community.However, Ikenberry argues in his book, America Unrivalled, that there are limits to the United States hegemony such as it stands at the moment. He is of the opinion that a complete hegemonic order would require not just preponderant capabilities but also some significant degree of acquiescence on the part of other states, particularly the o ther major players in world politics for the maintenance of such order. Following the Cold war, America acquired the support and cooperation of one of the major players in that region, Japan. Japan was once Americas closest ally as a result of this, however even Japan is becoming resentful, as presumably are the rest of the world, at Americas increase unilateralism (as in the North Korean case mentioned above) and the selective choice of multilateralism only when it favours the nation in one form of economic or security purpose or the other. It is therefore not impossible that other major players in the world, on examining their alternatives on how to best rid America of its hegemonic status and by so doing release the unsuspecting world from American domination, may very well challenge its hegemonic position. Capitalising on the regional and international relationships once promoted by America, the other major super powers in the Asian role and the European Union could orchestrate an over throw of Americas position as an hegemonic state or at the very least challenge the same. Not ignoring the power and importance of smaller or weaker states however, they would preferably naturally also have to be involved. This however would be an all scale war, the magnitude, repercussion and significance of which will tremble the world perhaps more than every previous wars put together Any would-be(prenominal) hegemonic challenger would most naturally have already arrived at the very same conclusion. Apart from the fact that every single one of these would-be challengers rely on the United States for one aspect of its sustenance or the other, it would take a lot of consideration, meetings, strategising and concrete persuasion to convince every member state of the necessity of such a global war. With its present and ever growing resources both at home and abroad, it is therefore only a matter of time before America, at whom the war is intended, becomes aware of the plans and builds up enough or adequate defence against the same. While it is not impossible that several nations of the world may come together and challenge Americas build up to hegemony, to say that the world may never recover from such a large scale war may perhaps be the understatement of the existence of mankind. In a brief state of fantasy, were one to assume that this large scale war does take place and does remove America from the pinnacle of power it currently occupies, there is no telling how many decades or even centuries it would take to rebuild a world of international trade and globalisation. Another danger in that is another country seizing the opportunity and rising very promptly to the throne of hegemony, in this instance however, a country not so democratically inclined as America, for instance, China. The world as we know it now may cease to exist as a result of such a war. It is now 2008 yet traces of the Second World War assuage remain evident in some areas in the Eastern part of Germany as one imagines it does in other affected parts of the world. If the argument here is then that a full blown war against Americas hegemony may do the world greater harm than good, what then can possibly stop Americas climb to the top of the world?As mentioned earlier, the strength of any nation lies in its economic as well as military growth. One, quite naturally, is not gratis(p) of the other however as training camps, gears and facilities will be touchy to procure without a booming economy. Should the world then experience a global economic crisis, the like of which it is yet to ever experience, perhaps this will in a way also bring America to the same level as other countries or at least less dominant? In this present day, at least the European Union and America are experiencing an economic crisis that has been likened to the worst in many decades till date. The Great Britains Royal Bank of Scotland recently announced that the country is indeed in reces sion. China and Japan have also reported major decline in sales and poor performances on their breakwater Street equivalent. Japan has actually announced to the world, like Great Britain, that it is indeed in the middle of a torrid recession. While this economic crisis may very well be unpleasant and indeed wrecking a lot of harm on the economy of the countries involved, it will take much more than this to cripple America or to reduce its hegemonic status. Even at this point in time, the US Dollar continues to rise against the British bewilder and the Euro. Should the world experience an economic crisis of such negative significance that all the major states as well as even the ones considered smaller and weaker are effectively affected, Americas hegemony, in my humble opinion, will most certainly be thoroughly challenged. This will be brought about by the fact that the international community in a bid to give out and revert to some semblance of normality will be force to depend one on the other for that means to survival, America included. such a scenario will almost take the world back in history to the early days when the advantages of globalisation and inter dependence of nations on one another was first discovered. Such an economic crisis will render it almost impossible for states to continue to concentrate on military training and equipments. One should imagine that nations will be more concerned with the immediate welfare of their people such as housing, medical care and social services as undoubtedly unemployment will rise astronomically in the face of an economic crisis of any significant magnitude.From everything hereinabove appearing and the examination of different (learned) opinions as well as scenarios, it is therefore perhaps appropriate to terminate by agreeing with the debate that should a full blown war orchestrate by would-be challengers of Americas hegemonic state fail, surely an economic crisis of significant global scale will not o nly challenge but also probably, however temporarily, bring an end to Americas hegemony. America will be forced to revert to the multilateralism way of international politics and to abandon unilateralism in a bid to promote globalisation and a closer knit international community.BibliographyJohn, G. Ikenberry, America Unrivalled The proximo of the Balance of Power (Cornell University Press, 2002)John, Ikenberry, Is American Multilateralism in Decline? Perspectives on political relation 13 (2003)Hegemony or Empire The Redefinition of US Power under George W. Bush, Edited by Charles-Philippe David and David Grondin (2006)Richard Little, Michael Smith, Perspectives on World PoliticsIkenberry, G. John, Liberalism and Empire Logics of distinguish In The American Unipolar Age, Review of planetary Studies (2004)Stephen M. Walt, care the World Off-Balance Self-Restraint and U.S. Foreign Policy, in Ikenberry, America Unrivalled, pp. 121-154.Charles A. Kupchan, hollo Hegemony or Stable M ultipolarity?, in G. John Ikenberry (ed.), America Unrivalled The prospective of the Balance of Power (Ithaca, NY Cornell University Press, 2002), p. 72. According to Kupchan, the European Union is emerging as the main competitor of the United States in a future multipolar international system.Whither American Power? David Held and Mathias Koenig-Archibugi Published in American Power in the Twentieth-First Century, edited by David Held and Mathias Koenig-Archibugi, Cambridge Polity Press, 2004.Kennedy, Paul, The Rise and Fall of the Great Powers 1987Footnotes1 David Held and Mathias Koenig-Archibugi, Whither American Power? In American Power in the Twentieth-First Century2 G. John, Ikenberry America Unrivalled Pp 13 Quoted in Balz 2003, A14 Purdum 2002., 15 Ikenberry6 Quoted in Craig R. Whitney, NATO at 50 With Nations at Odds, Is It A Misalliance? New York Times 2, 19997 President of the United States, The National Security Strategy of the United States of America (Washington D.C. White House, September 2002), p. 30.8 G. John Ikenberry9 Paul Kennedy, The Greatest Superpower Ever, New Perspectives Quarterly, 19 (2002).10 Barry R. Posen, ascendancy of the Commons The Military Foundation of U.S. Hegemony, International Security, 28 (2003), pp. 5-46, p. 8.11 On the metier of U.S. supremacy see William C. Wohlforth, The Stability of a Unipolar World, International Security, 24 (1999), pp. 541.12 Argument was developed by Ikenberry 200113 Marshall and Mann, free grace Towards the United States is Dwindling Globally
Design A 1 Bit Serial Adder Computer Science Essay
Design A 1 Bit nonpar al onenessel publication common viper Computer Science EssayThe main civilise of this scheme is to design a 1- rubbish back-to-back common viper, simulate its functionality and obtain a layout on silicon, development the 0.35 process from AMS. The electric circuit designed shows a on the job(p) att terminateant adder quantifying at (100MHz of nsecs) with a delay of 0.56910nsec. The argona of the layout is 99.3016.35 m2 in this technology. The circuit performs an 8- dapple asset in 0.569108 nsesc. The circuit subprograms a standard 1- instant large adder and it has a feedback loop using a D- swop in gear up to transmit the involve silicon chip to the next excitant order. The final layout item of intersection has 3-input pads and 2- issue pads, with power and ground pads.The process known as accomp any(prenominal)ing improver of double star come is intumesce known in the computing and units subject of performing much(prenominal) acco mpanying double star adjunct ordinarily lie in a fundamental portion of more complex computation devices. In the past, such series adders for binary meter croak vote down employed vacuum cleaner tube circuitry for the more or less part and open accordingly been subject to the disadvantages that they ar relatively in large size, fragile in configuration and be subject to operating(a) failures. These factors raise serious questions of disposition of components and problems of maintenance. The demonstrate plan serves to obviate the fore divergence difficulties and in essence provides a consecutive adder structure cap adequate to(p) of performing serious addition of binary issues. It is accordingly an object of the posture invention to provide an improved serial adder for drill in computing maskings.An object of the present invention resides in the grooming of an improved serial adder for binary digital applications employing magnetized amplifiers as components th ereof. An another(prenominal) object of the present invention is the provision of the serial adder for binary numbers which adders loafer be made in relatively smaller sizes. A salvage further object of the present invention resides in the provision of a computation device comprising, in combination, a plurality of magnetic amplifiers and a plurality of gating devices so link with one another that the mathematical process known as a serial moment addition. The binary adder of the present invention includes provision for selective coupling the input train pulses to be added as well as conceptualise pulses produced by the device itself to the plurality of doorways, and the supplys be adapted by themselves to selectively pass foretell pulses required for the function or inhi playion of the plurality of magnetic amplifiers mentioned supra. In digital systems, digital preindication processing and control systems we coffin nail control it when we be able to count. Addition is the fundamental operation for all these systems.The fastness and accuracy ar mettlesomely crookd by the adders we be use for the circuit design. common vipers ar precise important components in the digital components because of their extensive use in digital trading operations such as multiplication, entailment and division. The deed of binary operations inside a circuit would be greatly advanced by improving the surgical procedure of the digital adders. The main aim of aim the dapple serial adder is toPerform one bit at a time, using the number one bit operation results to influence the processing of posterior bits. It reduces the amount of ironware required as it passes all the bits in the equal logical system. However this approach needs 1/nth part of hardware when compared to the n-bit parallel adders. As we are using 1-bit or else of n-bits its structure reduces the foretoken routing and performs at high speed as we are using 1bit scan for the temporary store and one encompassing adder rather than an n-bit adder. The drop-off in the price of the logic results in taking n time cycles to execute this serial hardware, whereas parallel hardware executes in one clock cycle. This bit structure deals with the bit stream hence this have been successfully utilize in many applications like digital systems, digital signal processing, control systems etc. It was extremely popular in 2-5u technology range. The performance of a digital circuit break off is gauged by analysing its power dissipation, layout field of record and its operating speed.The main aim of this project is to design a 1-bit serial adder. Through this project research we astonish the knowledge of working doings and performance of the 1-bit serial adder. Adders are the basic components for the designing of any digital circuit. Adders are very important components in the digital components because of their extensive use in digital operations such as multiplication, su btraction and division. The execution of binary operations inside a circuit would be greatly advanced by improving the performance of the digital adders. The main aim of designing the bit serial adder is to perform one bit at a time, using the first bit operation results to influence the processing of subsequent bits. Here in this case the one bit serial adder is designed by using a flip over and full adder. .This circuit has deuce defends full adder salute for the addition of cardinal bits that are entered serially and irregular stage is flip- mighty stage which temporarily stores the guide until the next stage is processed. The temporary storage of the leave in the flip-flop depends on the clock pulse. Its design principle shows how the devil inputs entered serially. These two inputs volition be added by the full adder on with the carry which was temporarily stored by the flip-flop and gives us the summarise outturn and carry produce. The normal 1-bit serial adder use s the XOR inlets from the available stub program library. But in this XOR penetration there is an OR supply which normally reduces the performance of the XOR ingressway. therefrom the circuit has been modified by designing the XOR approach by using the NAND gate.What we would like to do now is find the subdued way to use the sub tractor along with the serial adder circuit. By using this sub tractor we can subtract the get down bit tax from high value.This binary sub tractor has been added to one of the input which we are persuasion to subtract the value. In our serial adder circuit the sub tractor is link up to the one of the inputs Y which is usually a XOR gate. This results in the subtraction of Y value from higher bit set.BACKGROUND2.1 AdditionAddition is a process of adding bits. Binary addition means adding binary bits 0s and 1s and sum and carry generated in binary farm in any signal processing. instantly lets consider the 4-bit addition example,As shown above A and B bits added swelled brotherhood out by rippling the carry at apiece stage and C4 as final carry obtained.2.2 SubtractionSubtraction is a process of adding a constructive bit to the negative bit. Negative of a bit means 2s flattery of it. This is cryptograph only when adding 1 bit to LSB of its 1s compliment. 1s compliment is nothing exclusively reversing the logic of the bits. Now lets consider the 4-bit subtraction example,The above subtraction technique dedicate to the subtracting a smaller binary from a larger binary. If it changes it just followed by few more locomote as change sign bit (MSB) to zero, because change it to its 2s compliment as before process.Metal-Oxide-Silicon knowledge base-Effect junction transistors (Mosfets)NMOS TransistorHere is a diagram of nmos transistorThe source and drain are connected to the two blobs of n-type semi take upor material. Thegate is on top, separated (and electrically insulated) from the rest of the transistor by a t hin layer of silicon dioxide (same material as sand doesnt conduct at all). The source and drain are separated by p-type material. This forms two diodes pointed in opposite directions (when you have n-type next to p-type material, you get a diode), so no current can flow mingled with the source and drain. When a high voltage (higher than the voltage level of the source, which is defined as the lower voltage of the two end terminals) is applied to the gate, it puts a positive safekee gloamingg on the gate. This attracts a negative charge in the region underneath the gate (opposite charges attract), forming a channel of negative charge carriers or an n-channel between the source and drain, which allows current to flow. So the nMOS transistor conducts when the gate is raised to the high voltage level, which we consider to be the logic level for 1 (true).PMOS junction transistorThe pMOS transistor is the dual of the nMOS transistor. You can look at the same diagram, but swap every n and p, and every + and -. Now, when the voltage at the gate is lower than the source (the higher voltage of the two end terminals for a pMOS transistor), we end up with a negative charge on the gate, which induces a positive channel underneath the gate, which allows current to flow. So the pMOS transistor conducts when the gate voltage is low, which we consider to be the logic level for 0 (false).The full names of what is being described are enhancement path n-channel or p-channel metal-oxide semiconductor field effect transistors (MOSFET). Enhancement mode refers to the fact that we have to create the channel by applying voltage to the gate. (There are also depletion mode transistors that have a channel built in to start with.) Field effect refers to the fact that were using the electric field from the charge at the gate to control things. Metal-oxide semiconductor refers to the fact that were using an oxide to insulate the gate from the rest of the transistor. The two types of t ransistors are named for the channel nMOS has an n-channel pMOS has a p-channel.CmosThere are many ways to move over logic render (not to be busted with the gate of the transistor) out of transistors. What Im showing here is the dominant way that gates are done in digital electronics today, but there are many variations out there. This is called static CMOS logic. Static refers to the fact that there are not clocks involved. CMOS stands for complementary metal-oxide semiconductor. The complementary means we have twain nMOS and pMOS transistors.The intuition behind this design style is aboveboard. start-off, you dont want to have nMOS and pMOS transistors entangled up close to each other, because they need to be created on varied types of substrate. So the natural style is to have a bunch of nMOS transistors unitedly that pull the railroad siding one way for certain input values, and a bunch of pMOS transistors together that pull the production the other direction for the other input values. It turns out to work better to have the nMOS transistors pull down toward logic 0 and the pMOS transistors pull up toward logic 1. This is both for electrical reasons (nMOS conducts 0 better pMOS conducts 1 better) and also to make it easy to get inverting gates.The following diagram showing how to make an inverter (a NOT gate)Such that we veritable CMOS Technology by combination of Pull-up lucre of PMOS Transistors and Pull-down network of NMOS Transistors. each the CMOS gates are constructed using as shown below.CMOS Constructed by, PMOS transistors in Pull-up network stage and NMOS transistors in Pull-down network stage. railroad siding going 1-0The Pull-down NMOS transistors discharges the output capacitance.OUTPUT going 0-1The output capacitance is supercharged through Pull-up PMOS transistors.MOSFETs change states in CMOS TransistorCMOS logic is better logic than PMOS and NMOS implementations individually. Because PMOS transistors are great at transmit ting a logic 0 to1 voltage without signal loss, NMOS transistors are great at transmitting a logic 1 to 0 voltage.4.2 NAND GATEConstructed by, As shown below PMOS transistors in parallel and NMOS transistors in series.OUTPUT going 1-0 The series NMOS transistors discharges the output capacitance.OUTPUT going 0-1The output capacitance is charged through parallel PMOS transistors.Circuit diagram of NAND entryLogic type of NAND GateTruth table of NAND GateABOUTPUT0010111011104.3 NOR GATEConstructed by, As shown NMOS transistors in parallel and PMOS transistors in series.OUTPUT going 1-0The parallel NMOS transistors discharges the output capacitance.OUTPUT going 0-1The output capacitance is charged through series PMOS transistors.Circuit diagram of NOR GateLogic symbol of NOR GateTruth table of NOR GateXOR GATEXOR is also called scoop shovel OR gate or EOR gate. This is a digital logic gate, which is utilize to express the function of Exclusive Disjunction. Its behavior is similar t o or gate with exclusive condition. Usually it is a 2-1 input output IC respectively.An output naughty (1) will be resulted if one, and only one of its 2 inputs is HIGH (1). Result of output LOW (0) both the inputs should be same both low or high. We can say EX-OR gate as maven or another, but not both.XOR gate is used to develop a binary addition. It gives the sum for inclined input bits. As shown above xor of 2 bits A and B gives its sum.A xor B = A.B + A.BCircuit diagram of xor gateBASIC common viper UNITAddition of two binary numbers is the most basic arithmetic operation i.e. two bits. A combinatory circuit which can add only two bits is known as half(prenominal) adder. A full adder is one that adds more than two bits i.e. three bits. Full adder uses two adders in its implementation. In this study full adder is the basic addition employed in all adders.HALF common viper half is a basic adder circuit that can perform addition of two bits and gives the output of sum and car ry. Half adder circuit uses an Exclusive-OR and AND gates for sum and carry outputs. XOR gate gives the sum output and carry output is given by the AND gate. X and Y are inputs S is sum and C0 is carry.S = X.Y + X.Y = X YC = X.YIts schematic representation is as shown in the figure.The law table of half adder is as shown below.XYSUMC00000011010101101K-MAPPING of half adder circuit is given as shown below.Sum, S = X YCarry, C0 = X.YFULL-ADDERFull adder can be formed by combining two half-adder circuits followed by the OR gate. It can perform the addition of three bits along with the carry input given as output from the previous one. The difference between half adder and full adder is that half adder cannot count more than two bits and cannot add the carry input which will be possible in full adder circuit. In this circuit, sum output is given by the XOR gate and the carry output is given by the AND gate followed by the OR gate. The stop consonant diagram of full adder circuit is as shown below.FULLADDERSum S = X Y CI = (X Y) CICarry C0 = (X .Y) + (X Y).CIAs shown in the above figure X, Y and CI are the adder inputs.The integrity table of the above circuit is as shown below.XYCISUMC00000000110010100110110010101011100111111By using K-map pivot mang we will get SUM and CARRY as followsSum S,Carry c0,D FLIP FLOPD- Flip flop is used in many applications. RS flip flop is the fundamental building block for the D- flip flop. It has only one entropy input. That is connected to the input S of RS flip flop where as D is inversely connected to the R input.. D- Flip flop is also having second input for holding the data which is known as Enable, simply represented as EN. The enable input is AND-ed with the D- Flip flop. D- Flip flop holds the data according to the clock pulse.It is constructed by using AND gates and NOR gates as shown in the below figure. D and EN are the inputs and Q and Q are outputs. The block diagram of the D-flip flop is as shown below.D- Fl ip flop acts as temporary data storage in the 1- bit serial adder. Its storage capacity depends on the number of stages. The storage capacity of the D- flip flop in this serial adder is the fall number bits (0 and 1) of digital data it can retain.Its truth table is a shown below.DENQQN0 locomote edge0X0Rising edge011Falling edgeQprevX1Rising edge10.The wave forms are attached in the results.CHAPTER 2SERIAL ADDERThe process known as serial addition of binary numbers is well known in the digital and units candid of performing such serial binary addition ordinarily comprise a basic portion of more complex computation devices. In the past, such serial adders for binary numbers have employed vacuum tube circuitry for the most part and have accordingly been subject to the disadvantages that they are relatively in large size, fragile in configuration and are subject to operating failures. These factors raise serious questions of disposition of components and problems of maintenance. The present invention serves to obviate the forego difficulties and in essence provides a serial adder structure capable of performing full addition of binary numbers. It is accordingly an object of the present invention to provide an improved serial adder for use in digital systems.The main aim of designing the bit serial adder is to perform one bit at a time, using the first bit operation results to influence the processing of subsequent bits. Here in this case the one bit serial adder is designed by using a D-flip flop and full adder. .This circuit has two stages full adder stage for the addition of two bits that are entered serially and second stage is D-flip flop stage which temporarily stores the carry until the next stage is processed. The temporary storage of the carry in the D-flip flop depends on the clock pulse. Its design principle shows how the two inputs entered serially. These two inputs will be added by the full adder along with the carry which was temporarily stored by the flip-flop and gives us the sum output and carry output. This is a practical serial adder that is used to add astream of two bits addition. First it takes the Least Significant Bits (LSB) in addition. Its block diagram is as shown in the figure.As shown in the above figure the inputs Xi and Yi are serially entered into the full adder along with the temporary carry from the D-flip flop i.e. Ci and gives the carry output Ci+1 and sum output Si.Hence serial adder is simple and because of feedback looping bit delays are expected. It can be constructed with very low cost and it is the perfect adder at low speed operations.Si = Ci Yi XiCi + 1 = Yi . Ci + Xi . Ci + Xi . Yi = Ci . (Xi Yi) + Xi . YiThe above equations represent the Sum and Carry outputs using Boolean equations.The construction of 1-bit serial adder is as shown in the figure. As shown in the figure the inputs X and Y are serially entered through the full adder along with the carry input which was the feedback output of full adder. In this circuit, sum output is given by the XOR gate and the carry output is given by the AND gate followed by the OR gate. D- Flip flop used in this circuit acts as a temporary storage of carry.TRUTH instrument panelXYC00SCO0011001101101011100100110011011110111001This entire design process and simulation can be done by using the mentor graphics reading 2005 software.Chapter 3Nand gate design of serial adder4.4 NAND gate is infract THAN NOR.As PMOS in parallel and NMOS in series the resultant renewal delay at NAND gate is lesser than delay of NOR gate computer architecture.To make PMOS as fast as NMOS we need enlarge channel and P-regions, but that leads to large silicon layout, and more cost and power wastage. So At same speed NOR is always larger than NAND. So it makes NAND more cost-efficient than NOR. W/L ratio of NAND gate is smaller than NOR gate.If inputs for gates are more then, NAND will be very hurrying than NOR.So we use sop implementation rather than pos.XOR GATE USING NAND GATESIn PMOS holes flow very slowly when compared to the electrons in the NMOS technology. Hence NMOS is faster than PMOS transistor. In NOR gate PMOS transistors are connected in series and in NAND gate PMOS transistors are connected in parallel hence NAND gate is faster than the NOR gate. Now considering another case to make this one bit serial adder little bit faster compared to the normal one bit serial adder the XOR gate is constructed by using the NAND gates which full treatment faster than the normal XOR gate. The reason for constructing this XOR gate is that in the fondness library we are using to design the entire circuit XOR gate internally contains an OR gate which usually reduces the performance of XOR gate. Its circuit diagram is as follows.XYOUT000011101110Its truth table is as shown below.D- Flip Flop using nand gatesD Flip-Flop is the most popular Flip-Flop. As its output takes the value of data ( D ) input when the positive edge of clock pu lse. D turn around can be interpreted as a unmannered memory cell.D Flip-flops are basically used as swop registers. As a D Flip-flop can produce a output signal with a time period delay of given clock pulse for an input signal i.e., one bit shifted skillful to the input given signal. The principle of D flip-flop is it captures the signal at the moment the clock goes high, and subsequent changes of the data lines do not influence Q until the rise of next clock edge. thus it works as a edge triggering mode at clock signal rising.D Flip-flop is constructed using NAND gates as shown above, where D and CLOCK are the inputs and Q and QN are the out puts.XYC00SCO0011001101101011100100110011011110111001CHAPTER 3SUBSTRACTORUp to now we have seen how simple logic gates perform binary addition. It is only rational to assume that the same circuit can also perform the binary subtraction. If we look at the possibilities involved in subtracting one bit number from another, we can quickly see that three of the four possible combinations are easy and straight forward. The fourth one involves a bit more.0 0 = 01 0 = 11 1 = 00 1 = 1, with a borrow bit.That borrow bit is just like a borrow in decimal subtraction it subtracts from the next higher order of magnitude in the overall number. The truth table of this sub tractor circuit looks like as shown below.This is an interesting result. The difference, X-Y, is still an exclusive-OR function, just as the sum for addition. The borrow is still an AND function, but is XY instead of XY.Adder/Subtractor logic developed using NAND gate (lower from higher)Addition is adding positive two bits. Subtraction is nothing but an addition where we add one positive bit to another negative bit. That means the second bit will be the positive number with negative polarity. We can metamorphose positive binary to negative binary by its 2s compliment.2s compliment is nothing but adding 1 bit to the LSB side of 1s compliment.1s compliment is i n any binary canon if we swap bits by 1 bit with 0 bit and 0 bit with 1 bit. That is flip the binary code image.1s compliment can be generated using XOR logic. when we give one pin of XOR gate dedicated to positive as logic 1, and other pin connected to the input binary bit, then output of EXOR will be swapped by 1s with 0s and 0s with 1s. At the same time other advantage is if the dedicated input pin is given logic, then out put will be same as input binary code.Such that in that whole circuit by ever-changing selective pin as 0 logic it works as adder and by changing selective pin as 1 logic it works as subtractors 1s compliment input.Let we consider A + B it is a simple addition,ForA B = A + (- B) = A + (B 1s compliment + 1)= A + B 1s compliment + 1As shown above to find A B we give the full adder inputs as a to A, b to B 1s compliment and finally c in as positive logic 1. Thus adding 2 bits of A And B in this way we get A- B.Above developed subtractor circuit subtracts lower value bit from higher value bit so in 0-1 condition its not valid.ADDER TRUTH remand WHEN EN =0ENXYC00SCO000110001101010101011001SUBSTRACTOR TRUTH TABLE WHEN EN =1ENXYC00SCO1001001011XX110110111101IMPLEMENTATIONThe entire process of designing and layout of the 1-bit serial adder circuit is done by using the mentor graphics version 2005. The required logic gates and flip flop has been taken from the effect library. erstwhile taking all the required components from the core library wiring has been done again using the core library. oneness wiring has been done the sheet has been saved and done the schematic check. Once the schematic check has been done successfully then the view point has been created. Once view point has been done successfully the circuit has been crusade for simulation. After having done the simulation successfully the output waveforms has been checked. This output waveforms results the working of the entire circuit design. Once we got the outputs exactly what we are looking for we then go for layout design. This layout design is also done by using the core library which is known as silicon layout. After finishing the layout we will check the overflow of the IC which we will get at the end of the process.ConclusionIn the project of One Bit Serial Adder we obtained the knowledge about the functionality of adders and developed a fast adder using NAND gate Logic. We even obtain the knowledge about CMOS technology and functionality of IC Gates. As we developed using NAND gate logic implementation the architecture of IC will be much faster and efficient.From the obtained results of Serial adder waveforms and IC design by comparing the theoretical and practical values are verified each other. Such that I can cease the developed ICs are well functioning in any application era with a delay of 0.5921ns.Finally I concluded that a 1-bit Serial adder is developed in Conventional, NAND gate architecture and Adder/Subtractor architectures IC design an d layout of IC design obtained and verified without errors. Functional and galvanising Characteristics studied similar to CMOS technology as they developed.
Friday, March 29, 2019
A Silent Mutation With Unknown Mechanism Biology Essay
A Silent Mutation With Un cognise Mechanism biological science EssayA silent mutation with unknown mechanism of C1311T in exon 11 feature with IVS11 T93C (G6PD 1311/93) has been reported in G6PD deficient undivideds in many populations. In our previous cartoon, G6PD 1311/93 was place as the cat valium G6PD variant in 1 of the Malaysian indigenous groups. Here, we report the screening for this variant via PCR-RFLP method and then direct sequencing of the entire 3UTR of the G6PD divisor in 175 aboriginal volunteers and 45 non-aboriginals. In the aboriginal group, 72 individuals (41%) carried the G6PD 1311/93 while 6 individuals (13%) were determine in the non-aboriginal set. Three newfangled SNPs, ss218178027 (+272 G/A), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) were sight in 3UTR. SNP ss218178024, which is hardened indoors an AG-rich neck of the woods, has shown a signifi open firet tie with G6PD 1311/93 as it was discovered solely in individuals with G6PD 131 1/93. Computational analyses indicated that three miRNAs rent potential to hold in to the characters encompassing ss218178024. Whilst converts of A to G dose not destroy these miRNA keister identifys, it extensively interpolates the informational RNA auxiliary social system and creates a putative hsa-miR-877* back site. Notably, ss218178027 and ss218178028 do not change messenger RNA lowly structure. It could be speculated that ss218178024 have a potential dishal effect on the down- jurisprudence of informational RNA and whence G6PD want either by locomoteing mRNA thirdhand structure or mirRNA regulation process. This is the first report of clinical link of a SNP in 3UTR of G6PD mRNA.Genetic variations in the G6PD agent ar responsible for G6PD deficiency in humans. More than 140 ethnic reliant stem variations in the G6PD constituent have been reported (Nkhoma et al 2009). Most of these variants argon single missense mutations, with the rest being either double or manifold missense mutations or small in frame deletions (Cappellini, G Fiorelli 2008). All these mutations alter the protein era of the G6PD enzyme by either amino acid re-sentencing still for a silent mutation of C1311T in exon 11 combined with IVS11T93C (designated here as G6PD 1311/93). This geno caseful has been reported in G6PD deficient individuals in different ethnic populations with different frequency (Vulliamy et al. 1991 2000 Jiang et al. 2006 Daoud et al. 2008 Jalloh et al. 2008 Wang et al. 2008 Moiz et al. 2009 ). This combination is a finicky G6PD variant where the carrier is deficient without any changes to the protein successiveness of the G6PD enzyme. From previous studies, association of these two has been shown as signifi quartert in reducing G6PD enzyme activity in some individuals and hence has clinical implications (Yu et al 2004 Wang et al 2008 Jiang et al 2006). It is famed that some of the individuals with G6PD 1311/93 presented with normal G6PD activity (Jiang et al 2006). Bearing in mind, it is reasonable to postulate that other change(s) in the G6PD gene with potential linkage disequilibrium by this combination is responsible for the enzyme deficiency.Importance of 3UTR of human genes in the post-transcriptional regulation has been supported by feeling of operable SNPs in the 3UTR of a number of genes ( referee). In the other word, genetic variations in the 3UTR of some genes argon associated with variety of human disease ( ref ). Cis-acting elements in the 3UTR of human genes are key players in controlling of mRNA stability, localization and level of supplanting (ref). Conversely, according to a recent taxonomical search, 106 conserved motifs located in the 3UTR of human gene are associated with post-transcriptional regulation which whiz-half of them likely are miRNA hold fast sites (Xie et al 2005). MicroRNAs (miRNAs) are a class of genes encoding short RNAs, which are known to hold gene flavour by sc reening to the 3UTR of the intent transcript. Notably, miRNAs are predicted to regulate about 30% of all human genes by targeting successivenesss in their 3UTR (ref) . Noteworthy, some(prenominal) SNPs inside the miRNA gene and the miRNA top sites have been identified recently (ref). The associations of these SNPs with some disease like Parkinson and some kind of send wordcer have been documented (Sethupathy 2008 Shen 2008).Given that, in the present study, we sought to reckon if any SNP in the 3UTR of G6PD gene in G6PD 1311/93 is take away in the regulation of mRNA affect.Subjects and MethodsThis study was approved by the University Kebangsaan Malaysia (UKM) hospitals ethical motive committee. All subjects gave their written informed consent.In our previous study, we attempted to find out the molecular(a) basis of G6PD deficiency in 25 deficient individuals from adept of the Malaysia aborigine group, namely, the Negrito ( entropy in press). Our earlier results showed tha t G6PD 1311/93 is the commonest G6PD variant in Negrito. No other mutations were detected in the remaining exons or adjacent regions of the G6PD gene for subjects with G6PD 1311/93. In the present study, blood was collected from 175 consenting volunteers from quadruple sub-ethnic groups of Negrito namely Kintak, Lanoh, Jahai, and Bateq. A series of 45 non-aboriginal volunteers were selected as the reference group. Genomic deoxyribonucleic acid was extracted by exploitation the Salting Out method (ref). The oligonucleotides use as primers were either designed by online primer-BLAST chopine or obtained from published data (Kurdi-Haidar et al. 1990). The G6PD gene place was obtained from NCBI (reference period NC_000023.9). Sequence of each exon was obtained from ENSEMBL (Transcript ENST00000393562). hence two regions of the G6PD gene (region ab and cd in figure 1) were amplified development the PCR technique to detect variation in nt 1311 in exon 11and nt 93 in intron 11. A p roportion of the PCR product from regions ab (207 bp) and cd (317 bp) were digested with the appropriate restriction enzyme according to the manufacturers instructions (New England Biolabs) and then run on 3% agarose gels, stained with ethidium bromide, and photographed under UV light. Region ab was digested with BclI and region cd was digested with NlaIII. For all samples, PCR direct sequencing was performed for 3 UTR of G6PD gene by using 2 sets primer of ef (320 bp) and gh (397 bp). pick up 1 Schematic map of social function of G6PD gene (exon 10 to exon 13). The arrows point to the scenes of each primer site. Oligonucleotides a 5 AAGACGTCCAGGATGAGGTGATC 3 and b 5 TGTTCTTCAACCCCG AGGAGT 3 are the primers employ to detect 1311 CT transition. Oligonucleotides c 5 TGGCATCAGCAAGACACTCTCTC 3 and d 5 CCCTTTCCTCACCTG CCATAAA3 are the primers used to detect IVS11 nt93 TC. Oligonucleotides e 5 GAGCCCTGG GCACCCACCTC 3 and f 5 TCTGTTGGGCTGGAGTGA 3 were amplified part of 3UTR and oligonu cleotides g (5TCACTCCAGCCCAACAGA3) and h (5 GGTCCTCAG GGAAGCAAA 3) were amplified the rest of 3UTR of G6PD gene for sequencing.Bioinformatic ToolsWe used two computational rotating shafts for each section to confirm our results. F-SNP (http//compbio.cs. queensu.ca/F-SNP/) ( lee Shatkay 2008) and FASTSNP (http//fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) was used to find putative functional SNP in 3UTR of G6PD gene. The RegRNA programme (http//regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http//bioinfo. uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to detect the miRNAs natural covering sites inside 3UTR of G6PD gene. Secondary structures of the amply-length of G6PD mRNA and as well, 3UTR was predicted using GeneBee (http//www.genebee.msu.su/genebee.html) and mFold (http//mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http//bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 20 04) was implemented as a tool for finding the minimum fire qualification hybridisation of mRNA and miRNA.ResultsGenotyping deoxyribonucleic acid from 175 aboriginals and 45 non-aboriginals were screened for presence of G6PD 1311/93. In overall 72 aboriginal individuals (41%) and 6 non-aboriginal subjects (13%) carried this combination (table 1). Through direct sequencing of DNA fragments, three fiction SNPs, of ss218178027 (+272 A/G), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) was form (Figure 2). SNP ss218178027 was notice in 6 subjects in aboriginal group with G6PD 1311/93 (table 1) inside of an AG-rich region (AGAAGGAAGGAGGAGG). SNP ss218178028 was observed in 4 aboriginal individuals which 3 of them carried normal alleles in 1311 and 93. no(prenominal) of our non-aboriginal samples carried ss218178027 or ss218178028. SNP ss218178024 also surrounds by other 30 bp AG-rich sequence (gggagggagggacaag ggggaggaaagggg) and it was observed in all those G6PD deficient ind ividuals who carried G6PD 1311/93. In the absence of G6PD 1311/93, ss218178024 was not found. Females who were heterozygote for the G6PD 1311/93 were also heterozygote for ss218178024.Figure 2. Partial nucleotide sequence of normal, heterozygote and homozygote females respectively for out front strand of ss218178024 (a1, a2, a3), reverse strand of ss218178027 (b1, b2, b3) and reverse strand of ss218178028 (c1, c2,c3). Arrows show position of each SNP.Table 2SNPIndividuals with G6PD 1311/93individuals normal for G6PD 1311/93ss218178024ss218178027ss218178028 primeval individual721057264Non-aboriginal individual637600Bioinformatics Analysis attend for reported SNPs inside of 3UTR of G6PD geneBy using F-SNP and FASTSNP programs, we found six SNPs have been reported inside of 3UTR of G6PD gene including SNP ref ID rs1050831,rs1050774, rs1050773, rs1050830, rs1063529, rs1050757.The last one is actually uniform with ss218178024. All of these known SNPs werediscovered via cDNA sequencing and to date no clinical associations have been reported for them. foretelling of putative miRNA binding sites and mRNA supplementary structureThe balmy sequence of 3UTR of G6PD was submitted to regRNA and MicroInspector programs to detect putative miRNAs target sites. The mutant variant of ss218178024, ss218178027 and ss218178028 was also submitted to tax effect of each SNP on creating or destroying the miRNAs target sites. However, in silico depth psychology indicated that three miRNAs have potential to bind to the regions encompassing ss218178024A. Of note, SNP ss218178024 is located inside seed region of these miRNAs which are hsa-mir-204, hsa-mir-211 and has-mir-1249 (figure 3). Moreover, further computational analyses give way that transition of A to G in SNP ss218178024 creates additional miRNA target site for has- miR-877* which also is located inside seed region. Neither ss218178027 nor ss218178028 is targeted by any miRNA. The RNAhybrid program (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum lax energy (MFE) hybridisation of mRNA and each miRNA.Figure 3 The predicted binding site for hsa-mir-211(A), hsa-miR-1249 (B), hsa- mir-204 (C) and hsa-miR-877* (D) at 3UTR of G6PD gene. Perfect Watson-Crick or transfer tie-up pairings between the 5 end of the miRNA and the 3 UTR target sites was observed. The minimum unblock energy (kcal/mol) of hybridization is shown in parentheses. Position of ss218178024G is indicated by arrows.Using the program mFold and Genebee, we determined the potential effect of the SNP sequence alterations on RNA folding. As shown in figure 4, ss218178024G is predicted to alter the secondary structure of G6PD mRNA. Also, the free energy of full length mRNA and as well 3UTR predicted to be touched by this substitution. The lower free energy in wild type indicates that mRNA might be more stable in wild type discriminate with the mutant. In the other word, it is suggesting that altered mRNA is adapted to faster adulteration. We also submitted the substituted nucleotide sequences of ss218178027A and ss218178028C to the GeenBee and mFold server. No change in the secondary structure of neither full length mRNA nor 3UTR was observed. It might be assuming that ss218178027A and ss218178028C do not probably modify mRNA processing.Consequently, secondary structure of 3UTR of G6PD mRNA has been also checked for the admissionibility of miRNA binding site. A stable base-paired duplex observe in the allele A (figure 4a2) and improper binding for allele G (figure 4b2) (arrows show position of changes). Then, it arouse be assume that miRNAs can be bind to the target site in mRNA due to the accessible site in the substitution of ss218178024G.Genotype Change in secondary structure Change in secondaryof full length of mRNA structure of 3UTR1311T No ss218178024G Yes Yes1311T+ ss218178024G Yes ss218178027A No No1311T + ss218178027A No ss218178028T No No1311T + ss218178028T No Figure 4 Predicted secondary structures of full length wild-type mRNA (A1) and 3UTR (A2) compare with predicted secondary structures of full length mRNA relating to allele 1311T plus ss218178024G (B1) and 3UTR relating to ss218178024G (B2). The free energy (kcal/mol) of thefull-length mRNA and 3UTR is shown in parentheses.Statistical Analysis word of honorA recent systematic study of G6PD deficiency indicated a spherical prevalence of 4.9% with varying frequencies among different ethnicities (Nkhoma et al. 2009). Although comprehensive studies have identified the molecular basis of G6PD deficiency worldwide, some pertinent questions remain to be addressed. For instance, several studies have reported deficient samples with unknown mutation(s) (Arambula et al. 2000 Nuchprayoon et al. 2008 Barisic 2005 Laosombat 2005 Pietropertosa 2001 Jiang et al. 2006). Additionally, the silent mutation genetic constitution of C1311T in exon 11 combined with IVS11T93C (G6PD 1311/93) does not explain the phenotype of G6PD deficiency in their carriers. Since there are appears to be no clear linkages to known sequence mutations with these examples, factors extrinsic to the G6PD gene sequence information need to be investigated. These factors whitethorn include the roles played by mRNA processing, the untranslated regions (UTRs) and restrictive function by miRNAs. To the best of our acquaintance the importance of mRNA processing and regulation by miRNAs has not been extensively studies with regards to G6PD deficiency. The roles of the UTRs of the G6PD gene have also not received much attention. Our literature search revealed two reports which had evaluated the role of the 3UTR of G6PD gene in their respective deficient population and these reports did not reveal any SNP in the 3UTR for G6PD deficient individuals (Nguyen Thi Hue 2009 Karadsheh 2005). Our present study attempts to shed light on the doable role(s) of the 3UTR of mRNA in G6PD deficiency, especially in the case of G6PD 1311/93.The ro les in disease phenotypes played by sequence polymorphisms of the 3UTR have been reported (Lambert et al. 2003 Goto et al. 2001 Yang et al. 2007). Here, we present the possibility that the SNP ss218178024 which we have identified in an AG-rich region of the G6PD 3UTR may participate in mRNA processing and can therefore be correlated with G6PD deficiency. There is, however, accumulating evidence on importance of some elements in the 3UTR like AU-rich, C-rich, CU-rich and AG-rich elements relating to mRNA stability by affecting mRNA secondary structure (SS). For instance, functional SNPs were found to pass on within AG-rich elements in some genes like Factor VII (Peyvandi et al. 2005), CYP2A6 gene (Wang et al. 2006), PTPN1 (Di Paola et al. 2002) and NPR1 (Knowles et al. 2003). Therefore, to gain further insights into the role of ss218178024 in G6PD deficiency, we have analyzed the SS of both(prenominal) full length mRNA and 3UTR. Significant alteration was predicted in the SS of fu ll length mRNA when we submitted the combination of 1311T and ss218178024G. Whilst in the SS of 3UTR, we observed a come-at-able standard Watson-Crick paired duplex in allele A whereas allele G has a reshuffling of the base pairings resulting in a differing SS prevision for the RNA sequence. The role of structure on RNA function is akin(predicate) to that of protein. Interestingly, SS of the either full length of mRNA or 3UTR including two substitutions of 1311T and ss218178027A or 1311T and ss218178028C was same with the SS of wild mRNA. This data is good in agree with subgenus Chen et al. (2006) which reported that non-functional SNPs in a gene usually have same secondary structure, but the functional SNPs usually change the mRNA secondary structure. Consequently, the free energy is affected by base substitution at ss218178024. In thermo stability point of view, the lower free energy (- 661.6 kcal/mol) in the SS of wild mRNA might be result in a more stable mRNA than mRNA with 1311T and ss218178024G. On the other view, SS contributes to fundamental interaction of restrictive elements with their target sequence in mRNA. In general, when target sequence is part of a stable base-paired with the other sequence of mRNA, the capacity of regulatory elements like miRNA to get involved in translational regulation could be diminished. Similarly, Hew et al. (2000) have been reported that an AG-rich region in elastin mRNA in chicken may affect mRNA stability and they proposed that alteration in SS in this region can affect the accessibility of endogenous RNse to the mRNA. Therefore, we postulated that miRNA binding site likely is not accessible in the wild mRNA due to its SS. When ss218178024G result in different mRNA SS the miRNA can access the target site as perfect complimentary of seed region is a key to the miRNA regulation. Nevertheless, recent evidence has discovered the significant miRNA expression in erythrocytes which dramatically altered in Sickle cell illness (ref). Thus, our hypothesis in miRNA regulation of G6PD mRNA is reasonable.While, SS is able to modify half life of mRNA, it is also capable to influence interaction of specific sequence of mRNA with regulatory proteins or miRNAs..Site accessibility is thought to affect the activity of a miRNA binding site. If the secondary structure is such that a potential miRNA binding site is part of a stable base-paired duplex, these bonds exit need to be broken before miRNAmRNA interaction can take place, effectively decreasing the fraction of mRNA molecules of a detail gene which is regulated by a miRNA in question. This could be one of the reasons some of the computational-predicted binding sites are inactive.Here, we demonstrate that a A357G mutation may potentially change the 3UTR secondary structure and create a binding site for hsa-miR-877* affects G6PD expression by either inhibiting mRNA translation or inducing mRNA degradation (Can you explain this bit to me over again when we meet).However, we gave evidence for the relevance of the SNP rs3 in G6PD deficiency in G6PD 1311/93 and possible explanation is linkage disequilibrium between this SNP with combination of 1311/93 inside of G6PD gene that might be affect the mRNA translation or stability through miRNA function.In conclusion, to the best of our knowledge, this study reports for the first prison term an association of a 3 UTR variant of G6PD in a large populations of G6PD 13111/93. However, functional studies are necessary to scrutiny this hypothesis.MicroInspector (http//www.imbb.forth.gr/microinspector) (Rusinov et al. 2005)W696-W700 Nucleic Acids Research, 2005, Vol. 33, Web Server issueMicroInspector a web tool for detection of miRNA binding sites in an RNA sequenceVentsislav Rusinov, Vesselin Baev, Ivan Nikiforov Minkov and Martin TablerTypically, SNPs occurring in functionalgenomic regions such as protein coding or regulatoryregions are more likely to cause functional distortion and,as such , more likely to underlie disease-causing variations.Current bioinformatics tools examine the functional effect of SNPs alone with respect to a single biologicalfunction. Therefore, much time and effort is required fromresearchers to separately use multiple tools and interpretthe (often conflicting) predictions. (F-SNP Lee at al)The variant ESR1_rs2747648 affects the miRNA-binding site ofmiR-453, miR-181(b/d) and miR-219. Due to in silico analysis usingmiRanda (http//www.microrna.org/microrna/home.do), the variantESR1_rs2747648 does not significantly effect the binding capacityof miR-219 and miR-181(b/d). However, the binding capacity of miR-453 is stronger when the C variant allele is present, enabling to bindthe completing G nucleotide of the miR-453 seed. In contrast, theT allele attenuates the binding of miR-453, which we opine tolead to a reduced miRNA-mediated ESR1-repression, in consequencehigher ESR1 protein levels and an increase breast cancer risk. Therefore,the breast cancer protective effect observed for the C allele isbiologically reasonable. However, functional studies are necessary totest this hypothesis. Due to the fact that endogenous estrogen levelsare high premenopausal and drop down post-menopausal, it is plausiblethat the risk effect of this variant can only be detected inpremenopausal women.RNA secondary structure prediction was carried outusing the capital of Austria RNA software 1.7.2. on the webinterface for online RNA folding on the Vienna RNAWebServers.42 The target mRNA prediction was carriedout using The microRNA.org resourcefulnessThis is likely because miRNA-mRNA bindingis mediated by the RISC complex, and upstream and downriverregions of miRNA binding site may interact with RISC, whichmediates miRNA-mRNA binding (26). A polymorphism in the829C site (SNP-829C3T) is located near the miRNA binding site. 2007 Mishra mirnaSNP rs12720208 is located 166 bp downriver of the terminatingcodon of FGF20 and lies within a predicted bi ndingsite for microRNA (miRNA) miR-433.(A) The predicted binding site for miR-433at 30 UTR of FGF20 gene. At rs12720208,allele C base paired with G in Watson-Crickmode (as shown with a solid line), whereasallele T wobble base paired with G (as shownwith a dashed line). geenbee 2009 capassoAlthough the mechanismby which interaction of proteins with the G3A sequence mightaffect message stability body a matter of speculation, thefact that this sequence is located within a large region of stablesecondary structure in the 39-UTR of the elastin mRNA (4)suggests the possibility that RNA/protein interactions at thissite may alter the stability of this secondary structure, perhapsaffecting the accessibility of endogenous RNases to the mRNA.However, detailed catch of the mechanism of thisprocess awaits further characterization of the nature of bindingprotein and the consequences of its interaction with the G3Amotif in elastin mRNA.Acknowledgment-We acknowledgeGA rich HewFrom a physical poi nt of view, we expect that theinteraction of a miRNA with its target go out depend on the state of the targetregion prior to interaction. In particular, if the target sequence is already bound(by Watson-Crick base-pairing) to another section of the mRNA chain, this wille_ectively pose a barrier to the base-pairing with the miRNA, and the capacity ofsuch target sequences to mediate translational repression could be diminished. Ifwe were able to predict the accessibility of a potential miRNA binding site, thismight improve our target predictions.gi109132849AGGGACAGCCCAGAGGA CTGAGCCACCTCCTGCGCTCACTCCAGCCCAACAGAAGGAAGGAGGAGGGgi108773792 CTGAGTCACCTCCTCCACTCACTCCAGCCCAACAGAAGGAAGGAGGAGGGgi194680256 CTGAGCCCCCCCCCCCCCACCCCACCGCCCGG-AGCAAGGAAGAGGAGGG***** * ** ** * * * * * **** ** * * * ********gi109132849AGGGACAGCCCAGAGGA TGCCCATTCGTCTGTCCCAGAGCTTCTCGGTCACTGGGGCTCACTCCTGAgi108773792 CGCCCATTCGTCTGTCCCAGAGCTTATTGGCCACTGGGTCTCACTCCTGAgi194680256 CTATAGTTGGGGAAGACAGGGGCAAGGTCCTCAGAAGGCCGAGA ** * * * ** ** ** * **gi109132849AGGGACAGCCCAGAGGA GTGGGGCCTGGGGCAGGAGGGAGGGACGAGGGGGAGGAAAGGGGCGAGCGgi108773792 GTGGGGCC-AGGGTGGGAGGGAGGGACAAGGGGGAGGAAAGGGGCGAGCAgi194680256 ATGGGCCCCCTGCACCCCCAGTCTCAGCGCCATTCCACATTCCTGGTCIt would be anticipated that increased DHFR reduces MTXcytotoxicity in normal cells while conferring apology in targetcells.A comparison of the human and mouse DHFR 39-UTR sequencesrevealed that only 100 nucleotides downstream from theterminator codon were conserved between the two species (18). legion(predicate)studies have focused on the effects of coding region variantson P-gp expression and function, whereas few noncodingregion variants have been investigated.Mechanisms that alter mRNA levels can change mRNA expressionand potentially G6PD activity. Recent evidence has demonstratethat the 3UTR of mRNA is an important regulatory site controllinginteractions with mRNA degradation machinery (Hollams et al., 2002Tourriere et al., 2002 Mangus et al., 2003 Wilkie e t al., 2003).3UTR RNA-binding proteins that recognize specific mRNA sequenceelements and secondary structure ordain the fate of mRNAtranscripts. Polymorphisms in the 3UTR of G6PD could disruptRNA-protein interactions, resulting in altered mRNA stability. The stability of mRNA may be altered by 3UTR polymorphisms if actualisation of specific mRNA sequence and secondary structure by regulatory proteins is disrupted (Shen et al., 1999 Hollams et al.,2002 Tourriere et al., 2002). A polymorphism in the 3UTR ofhuman tumor chagrin factor-_ changes binding affinity for a multiproteincomplex that contains the HuR regulatory protein (Di Marcoet al., 2001). HuR binds AG-rich elements in the 3UTR of definitegenes (Peng et al., 1998) and has been shown to stabilize mRNAcontaining tumor necrosis factor-_ 3_-UTR sequence motifs (Dean etal., 2001). There is one report that the 3435C_T synonymous variantdecreases mRNA stability (Wang et al., 2005), but to our knowledgeno pharmacogenetic research of this type has been conducted forABCB1 3_-UTR variants. Thus, our mRNA half-life data defendnovel findings as to the effects the _89A_T, _146G_A, and_193A_G polymorphisms have on ABCB1 mRNA stability anddemonstrate the utility of using stable cell lines made with Flp-In engineering science for these measurements. Similarly
Subscribe to:
Comments (Atom)