A Silent Mutation With Unknown Mechanism Biology Essay

A Silent Mutation With Un cognise Mechanism biological science EssayA silent mutation with unknown mechanism of C1311T in exon 11 feature with IVS11 T93C (G6PD 1311/93) has been reported in G6PD deficient undivideds in many populations. In our previous cartoon, G6PD 1311/93 was place as the cat valium G6PD variant in 1 of the Malaysian indigenous groups. Here, we report the screening for this variant via PCR-RFLP method and then direct sequencing of the entire 3UTR of the G6PD divisor in 175 aboriginal volunteers and 45 non-aboriginals. In the aboriginal group, 72 individuals (41%) carried the G6PD 1311/93 while 6 individuals (13%) were determine in the non-aboriginal set. Three newfangled SNPs, ss218178027 (+272 G/A), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) were sight in 3UTR. SNP ss218178024, which is hardened indoors an AG-rich neck of the woods, has shown a signifi open firet tie with G6PD 1311/93 as it was discovered solely in individuals with G6PD 131 1/93. Computational analyses indicated that three miRNAs rent potential to hold in to the characters encompassing ss218178024. Whilst converts of A to G dose not destroy these miRNA keister identifys, it extensively interpolates the informational RNA auxiliary social system and creates a putative hsa-miR-877* back site. Notably, ss218178027 and ss218178028 do not change messenger RNA lowly structure. It could be speculated that ss218178024 have a potential dishal effect on the down- jurisprudence of informational RNA and whence G6PD want either by locomoteing mRNA thirdhand structure or mirRNA regulation process. This is the first report of clinical link of a SNP in 3UTR of G6PD mRNA.Genetic variations in the G6PD agent ar responsible for G6PD deficiency in humans. More than 140 ethnic reliant stem variations in the G6PD constituent have been reported (Nkhoma et al 2009). Most of these variants argon single missense mutations, with the rest being either double or manifold missense mutations or small in frame deletions (Cappellini, G Fiorelli 2008). All these mutations alter the protein era of the G6PD enzyme by either amino acid re-sentencing still for a silent mutation of C1311T in exon 11 combined with IVS11T93C (designated here as G6PD 1311/93). This geno caseful has been reported in G6PD deficient individuals in different ethnic populations with different frequency (Vulliamy et al. 1991 2000 Jiang et al. 2006 Daoud et al. 2008 Jalloh et al. 2008 Wang et al. 2008 Moiz et al. 2009 ). This combination is a finicky G6PD variant where the carrier is deficient without any changes to the protein successiveness of the G6PD enzyme. From previous studies, association of these two has been shown as signifi quartert in reducing G6PD enzyme activity in some individuals and hence has clinical implications (Yu et al 2004 Wang et al 2008 Jiang et al 2006). It is famed that some of the individuals with G6PD 1311/93 presented with normal G6PD activity (Jiang et al 2006). Bearing in mind, it is reasonable to postulate that other change(s) in the G6PD gene with potential linkage disequilibrium by this combination is responsible for the enzyme deficiency.Importance of 3UTR of human genes in the post-transcriptional regulation has been supported by feeling of operable SNPs in the 3UTR of a number of genes ( referee). In the other word, genetic variations in the 3UTR of some genes argon associated with variety of human disease ( ref ). Cis-acting elements in the 3UTR of human genes are key players in controlling of mRNA stability, localization and level of supplanting (ref). Conversely, according to a recent taxonomical search, 106 conserved motifs located in the 3UTR of human gene are associated with post-transcriptional regulation which whiz-half of them likely are miRNA hold fast sites (Xie et al 2005). MicroRNAs (miRNAs) are a class of genes encoding short RNAs, which are known to hold gene flavour by sc reening to the 3UTR of the intent transcript. Notably, miRNAs are predicted to regulate about 30% of all human genes by targeting successivenesss in their 3UTR (ref) . Noteworthy, some(prenominal) SNPs inside the miRNA gene and the miRNA top sites have been identified recently (ref). The associations of these SNPs with some disease like Parkinson and some kind of send wordcer have been documented (Sethupathy 2008 Shen 2008).Given that, in the present study, we sought to reckon if any SNP in the 3UTR of G6PD gene in G6PD 1311/93 is take away in the regulation of mRNA affect.Subjects and MethodsThis study was approved by the University Kebangsaan Malaysia (UKM) hospitals ethical motive committee. All subjects gave their written informed consent.In our previous study, we attempted to find out the molecular(a) basis of G6PD deficiency in 25 deficient individuals from adept of the Malaysia aborigine group, namely, the Negrito ( entropy in press). Our earlier results showed tha t G6PD 1311/93 is the commonest G6PD variant in Negrito. No other mutations were detected in the remaining exons or adjacent regions of the G6PD gene for subjects with G6PD 1311/93. In the present study, blood was collected from 175 consenting volunteers from quadruple sub-ethnic groups of Negrito namely Kintak, Lanoh, Jahai, and Bateq. A series of 45 non-aboriginal volunteers were selected as the reference group. Genomic deoxyribonucleic acid was extracted by exploitation the Salting Out method (ref). The oligonucleotides use as primers were either designed by online primer-BLAST chopine or obtained from published data (Kurdi-Haidar et al. 1990). The G6PD gene place was obtained from NCBI (reference period NC_000023.9). Sequence of each exon was obtained from ENSEMBL (Transcript ENST00000393562). hence two regions of the G6PD gene (region ab and cd in figure 1) were amplified development the PCR technique to detect variation in nt 1311 in exon 11and nt 93 in intron 11. A p roportion of the PCR product from regions ab (207 bp) and cd (317 bp) were digested with the appropriate restriction enzyme according to the manufacturers instructions (New England Biolabs) and then run on 3% agarose gels, stained with ethidium bromide, and photographed under UV light. Region ab was digested with BclI and region cd was digested with NlaIII. For all samples, PCR direct sequencing was performed for 3 UTR of G6PD gene by using 2 sets primer of ef (320 bp) and gh (397 bp). pick up 1 Schematic map of social function of G6PD gene (exon 10 to exon 13). The arrows point to the scenes of each primer site. Oligonucleotides a 5 AAGACGTCCAGGATGAGGTGATC 3 and b 5 TGTTCTTCAACCCCG AGGAGT 3 are the primers employ to detect 1311 CT transition. Oligonucleotides c 5 TGGCATCAGCAAGACACTCTCTC 3 and d 5 CCCTTTCCTCACCTG CCATAAA3 are the primers used to detect IVS11 nt93 TC. Oligonucleotides e 5 GAGCCCTGG GCACCCACCTC 3 and f 5 TCTGTTGGGCTGGAGTGA 3 were amplified part of 3UTR and oligonu cleotides g (5TCACTCCAGCCCAACAGA3) and h (5 GGTCCTCAG GGAAGCAAA 3) were amplified the rest of 3UTR of G6PD gene for sequencing.Bioinformatic ToolsWe used two computational rotating shafts for each section to confirm our results. F-SNP (http//compbio.cs. queensu.ca/F-SNP/) ( lee Shatkay 2008) and FASTSNP (http//fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) was used to find putative functional SNP in 3UTR of G6PD gene. The RegRNA programme (http//regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http//bioinfo. uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to detect the miRNAs natural covering sites inside 3UTR of G6PD gene. Secondary structures of the amply-length of G6PD mRNA and as well, 3UTR was predicted using GeneBee (http//www.genebee.msu.su/genebee.html) and mFold (http//mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http//bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 20 04) was implemented as a tool for finding the minimum fire qualification hybridisation of mRNA and miRNA.ResultsGenotyping deoxyribonucleic acid from 175 aboriginals and 45 non-aboriginals were screened for presence of G6PD 1311/93. In overall 72 aboriginal individuals (41%) and 6 non-aboriginal subjects (13%) carried this combination (table 1). Through direct sequencing of DNA fragments, three fiction SNPs, of ss218178027 (+272 A/G), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) was form (Figure 2). SNP ss218178027 was notice in 6 subjects in aboriginal group with G6PD 1311/93 (table 1) inside of an AG-rich region (AGAAGGAAGGAGGAGG). SNP ss218178028 was observed in 4 aboriginal individuals which 3 of them carried normal alleles in 1311 and 93. no(prenominal) of our non-aboriginal samples carried ss218178027 or ss218178028. SNP ss218178024 also surrounds by other 30 bp AG-rich sequence (gggagggagggacaag ggggaggaaagggg) and it was observed in all those G6PD deficient ind ividuals who carried G6PD 1311/93. In the absence of G6PD 1311/93, ss218178024 was not found. Females who were heterozygote for the G6PD 1311/93 were also heterozygote for ss218178024.Figure 2. Partial nucleotide sequence of normal, heterozygote and homozygote females respectively for out front strand of ss218178024 (a1, a2, a3), reverse strand of ss218178027 (b1, b2, b3) and reverse strand of ss218178028 (c1, c2,c3). Arrows show position of each SNP.Table 2SNPIndividuals with G6PD 1311/93individuals normal for G6PD 1311/93ss218178024ss218178027ss218178028 primeval individual721057264Non-aboriginal individual637600Bioinformatics Analysis attend for reported SNPs inside of 3UTR of G6PD geneBy using F-SNP and FASTSNP programs, we found six SNPs have been reported inside of 3UTR of G6PD gene including SNP ref ID rs1050831,rs1050774, rs1050773, rs1050830, rs1063529, rs1050757.The last one is actually uniform with ss218178024. All of these known SNPs werediscovered via cDNA sequencing and to date no clinical associations have been reported for them. foretelling of putative miRNA binding sites and mRNA supplementary structureThe balmy sequence of 3UTR of G6PD was submitted to regRNA and MicroInspector programs to detect putative miRNAs target sites. The mutant variant of ss218178024, ss218178027 and ss218178028 was also submitted to tax effect of each SNP on creating or destroying the miRNAs target sites. However, in silico depth psychology indicated that three miRNAs have potential to bind to the regions encompassing ss218178024A. Of note, SNP ss218178024 is located inside seed region of these miRNAs which are hsa-mir-204, hsa-mir-211 and has-mir-1249 (figure 3). Moreover, further computational analyses give way that transition of A to G in SNP ss218178024 creates additional miRNA target site for has- miR-877* which also is located inside seed region. Neither ss218178027 nor ss218178028 is targeted by any miRNA. The RNAhybrid program (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum lax energy (MFE) hybridisation of mRNA and each miRNA.Figure 3 The predicted binding site for hsa-mir-211(A), hsa-miR-1249 (B), hsa- mir-204 (C) and hsa-miR-877* (D) at 3UTR of G6PD gene. Perfect Watson-Crick or transfer tie-up pairings between the 5 end of the miRNA and the 3 UTR target sites was observed. The minimum unblock energy (kcal/mol) of hybridization is shown in parentheses. Position of ss218178024G is indicated by arrows.Using the program mFold and Genebee, we determined the potential effect of the SNP sequence alterations on RNA folding. As shown in figure 4, ss218178024G is predicted to alter the secondary structure of G6PD mRNA. Also, the free energy of full length mRNA and as well 3UTR predicted to be touched by this substitution. The lower free energy in wild type indicates that mRNA might be more stable in wild type discriminate with the mutant. In the other word, it is suggesting that altered mRNA is adapted to faster adulteration. We also submitted the substituted nucleotide sequences of ss218178027A and ss218178028C to the GeenBee and mFold server. No change in the secondary structure of neither full length mRNA nor 3UTR was observed. It might be assuming that ss218178027A and ss218178028C do not probably modify mRNA processing.Consequently, secondary structure of 3UTR of G6PD mRNA has been also checked for the admissionibility of miRNA binding site. A stable base-paired duplex observe in the allele A (figure 4a2) and improper binding for allele G (figure 4b2) (arrows show position of changes). Then, it arouse be assume that miRNAs can be bind to the target site in mRNA due to the accessible site in the substitution of ss218178024G.Genotype Change in secondary structure Change in secondaryof full length of mRNA structure of 3UTR1311T No ss218178024G Yes Yes1311T+ ss218178024G Yes ss218178027A No No1311T + ss218178027A No ss218178028T No No1311T + ss218178028T No Figure 4 Predicted secondary structures of full length wild-type mRNA (A1) and 3UTR (A2) compare with predicted secondary structures of full length mRNA relating to allele 1311T plus ss218178024G (B1) and 3UTR relating to ss218178024G (B2). The free energy (kcal/mol) of thefull-length mRNA and 3UTR is shown in parentheses.Statistical Analysis word of honorA recent systematic study of G6PD deficiency indicated a spherical prevalence of 4.9% with varying frequencies among different ethnicities (Nkhoma et al. 2009). Although comprehensive studies have identified the molecular basis of G6PD deficiency worldwide, some pertinent questions remain to be addressed. For instance, several studies have reported deficient samples with unknown mutation(s) (Arambula et al. 2000 Nuchprayoon et al. 2008 Barisic 2005 Laosombat 2005 Pietropertosa 2001 Jiang et al. 2006). Additionally, the silent mutation genetic constitution of C1311T in exon 11 combined with IVS11T93C (G6PD 1311/93) does not explain the phenotype of G6PD deficiency in their carriers. Since there are appears to be no clear linkages to known sequence mutations with these examples, factors extrinsic to the G6PD gene sequence information need to be investigated. These factors whitethorn include the roles played by mRNA processing, the untranslated regions (UTRs) and restrictive function by miRNAs. To the best of our acquaintance the importance of mRNA processing and regulation by miRNAs has not been extensively studies with regards to G6PD deficiency. The roles of the UTRs of the G6PD gene have also not received much attention. Our literature search revealed two reports which had evaluated the role of the 3UTR of G6PD gene in their respective deficient population and these reports did not reveal any SNP in the 3UTR for G6PD deficient individuals (Nguyen Thi Hue 2009 Karadsheh 2005). Our present study attempts to shed light on the doable role(s) of the 3UTR of mRNA in G6PD deficiency, especially in the case of G6PD 1311/93.The ro les in disease phenotypes played by sequence polymorphisms of the 3UTR have been reported (Lambert et al. 2003 Goto et al. 2001 Yang et al. 2007). Here, we present the possibility that the SNP ss218178024 which we have identified in an AG-rich region of the G6PD 3UTR may participate in mRNA processing and can therefore be correlated with G6PD deficiency. There is, however, accumulating evidence on importance of some elements in the 3UTR like AU-rich, C-rich, CU-rich and AG-rich elements relating to mRNA stability by affecting mRNA secondary structure (SS). For instance, functional SNPs were found to pass on within AG-rich elements in some genes like Factor VII (Peyvandi et al. 2005), CYP2A6 gene (Wang et al. 2006), PTPN1 (Di Paola et al. 2002) and NPR1 (Knowles et al. 2003). Therefore, to gain further insights into the role of ss218178024 in G6PD deficiency, we have analyzed the SS of both(prenominal) full length mRNA and 3UTR. Significant alteration was predicted in the SS of fu ll length mRNA when we submitted the combination of 1311T and ss218178024G. Whilst in the SS of 3UTR, we observed a come-at-able standard Watson-Crick paired duplex in allele A whereas allele G has a reshuffling of the base pairings resulting in a differing SS prevision for the RNA sequence. The role of structure on RNA function is akin(predicate) to that of protein. Interestingly, SS of the either full length of mRNA or 3UTR including two substitutions of 1311T and ss218178027A or 1311T and ss218178028C was same with the SS of wild mRNA. This data is good in agree with subgenus Chen et al. (2006) which reported that non-functional SNPs in a gene usually have same secondary structure, but the functional SNPs usually change the mRNA secondary structure. Consequently, the free energy is affected by base substitution at ss218178024. In thermo stability point of view, the lower free energy (- 661.6 kcal/mol) in the SS of wild mRNA might be result in a more stable mRNA than mRNA with 1311T and ss218178024G. On the other view, SS contributes to fundamental interaction of restrictive elements with their target sequence in mRNA. In general, when target sequence is part of a stable base-paired with the other sequence of mRNA, the capacity of regulatory elements like miRNA to get involved in translational regulation could be diminished. Similarly, Hew et al. (2000) have been reported that an AG-rich region in elastin mRNA in chicken may affect mRNA stability and they proposed that alteration in SS in this region can affect the accessibility of endogenous RNse to the mRNA. Therefore, we postulated that miRNA binding site likely is not accessible in the wild mRNA due to its SS. When ss218178024G result in different mRNA SS the miRNA can access the target site as perfect complimentary of seed region is a key to the miRNA regulation. Nevertheless, recent evidence has discovered the significant miRNA expression in erythrocytes which dramatically altered in Sickle cell illness (ref). Thus, our hypothesis in miRNA regulation of G6PD mRNA is reasonable.While, SS is able to modify half life of mRNA, it is also capable to influence interaction of specific sequence of mRNA with regulatory proteins or miRNAs..Site accessibility is thought to affect the activity of a miRNA binding site. If the secondary structure is such that a potential miRNA binding site is part of a stable base-paired duplex, these bonds exit need to be broken before miRNAmRNA interaction can take place, effectively decreasing the fraction of mRNA molecules of a detail gene which is regulated by a miRNA in question. This could be one of the reasons some of the computational-predicted binding sites are inactive.Here, we demonstrate that a A357G mutation may potentially change the 3UTR secondary structure and create a binding site for hsa-miR-877* affects G6PD expression by either inhibiting mRNA translation or inducing mRNA degradation (Can you explain this bit to me over again when we meet).However, we gave evidence for the relevance of the SNP rs3 in G6PD deficiency in G6PD 1311/93 and possible explanation is linkage disequilibrium between this SNP with combination of 1311/93 inside of G6PD gene that might be affect the mRNA translation or stability through miRNA function.In conclusion, to the best of our knowledge, this study reports for the first prison term an association of a 3 UTR variant of G6PD in a large populations of G6PD 13111/93. However, functional studies are necessary to scrutiny this hypothesis.MicroInspector (http//www.imbb.forth.gr/microinspector) (Rusinov et al. 2005)W696-W700 Nucleic Acids Research, 2005, Vol. 33, Web Server issueMicroInspector a web tool for detection of miRNA binding sites in an RNA sequenceVentsislav Rusinov, Vesselin Baev, Ivan Nikiforov Minkov and Martin TablerTypically, SNPs occurring in functionalgenomic regions such as protein coding or regulatoryregions are more likely to cause functional distortion and,as such , more likely to underlie disease-causing variations.Current bioinformatics tools examine the functional effect of SNPs alone with respect to a single biologicalfunction. Therefore, much time and effort is required fromresearchers to separately use multiple tools and interpretthe (often conflicting) predictions. (F-SNP Lee at al)The variant ESR1_rs2747648 affects the miRNA-binding site ofmiR-453, miR-181(b/d) and miR-219. Due to in silico analysis usingmiRanda (http//www.microrna.org/microrna/home.do), the variantESR1_rs2747648 does not significantly effect the binding capacityof miR-219 and miR-181(b/d). However, the binding capacity of miR-453 is stronger when the C variant allele is present, enabling to bindthe completing G nucleotide of the miR-453 seed. In contrast, theT allele attenuates the binding of miR-453, which we opine tolead to a reduced miRNA-mediated ESR1-repression, in consequencehigher ESR1 protein levels and an increase breast cancer risk. Therefore,the breast cancer protective effect observed for the C allele isbiologically reasonable. However, functional studies are necessary totest this hypothesis. Due to the fact that endogenous estrogen levelsare high premenopausal and drop down post-menopausal, it is plausiblethat the risk effect of this variant can only be detected inpremenopausal women.RNA secondary structure prediction was carried outusing the capital of Austria RNA software 1.7.2. on the webinterface for online RNA folding on the Vienna RNAWebServers.42 The target mRNA prediction was carriedout using The microRNA.org resourcefulnessThis is likely because miRNA-mRNA bindingis mediated by the RISC complex, and upstream and downriverregions of miRNA binding site may interact with RISC, whichmediates miRNA-mRNA binding (26). A polymorphism in the829C site (SNP-829C3T) is located near the miRNA binding site. 2007 Mishra mirnaSNP rs12720208 is located 166 bp downriver of the terminatingcodon of FGF20 and lies within a predicted bi ndingsite for microRNA (miRNA) miR-433.(A) The predicted binding site for miR-433at 30 UTR of FGF20 gene. At rs12720208,allele C base paired with G in Watson-Crickmode (as shown with a solid line), whereasallele T wobble base paired with G (as shownwith a dashed line). geenbee 2009 capassoAlthough the mechanismby which interaction of proteins with the G3A sequence mightaffect message stability body a matter of speculation, thefact that this sequence is located within a large region of stablesecondary structure in the 39-UTR of the elastin mRNA (4)suggests the possibility that RNA/protein interactions at thissite may alter the stability of this secondary structure, perhapsaffecting the accessibility of endogenous RNases to the mRNA.However, detailed catch of the mechanism of thisprocess awaits further characterization of the nature of bindingprotein and the consequences of its interaction with the G3Amotif in elastin mRNA.Acknowledgment-We acknowledgeGA rich HewFrom a physical poi nt of view, we expect that theinteraction of a miRNA with its target go out depend on the state of the targetregion prior to interaction. In particular, if the target sequence is already bound(by Watson-Crick base-pairing) to another section of the mRNA chain, this wille_ectively pose a barrier to the base-pairing with the miRNA, and the capacity ofsuch target sequences to mediate translational repression could be diminished. Ifwe were able to predict the accessibility of a potential miRNA binding site, thismight improve our target predictions.gi109132849AGGGACAGCCCAGAGGA CTGAGCCACCTCCTGCGCTCACTCCAGCCCAACAGAAGGAAGGAGGAGGGgi108773792 CTGAGTCACCTCCTCCACTCACTCCAGCCCAACAGAAGGAAGGAGGAGGGgi194680256 CTGAGCCCCCCCCCCCCCACCCCACCGCCCGG-AGCAAGGAAGAGGAGGG***** * ** ** * * * * * **** ** * * * ********gi109132849AGGGACAGCCCAGAGGA TGCCCATTCGTCTGTCCCAGAGCTTCTCGGTCACTGGGGCTCACTCCTGAgi108773792 CGCCCATTCGTCTGTCCCAGAGCTTATTGGCCACTGGGTCTCACTCCTGAgi194680256 CTATAGTTGGGGAAGACAGGGGCAAGGTCCTCAGAAGGCCGAGA ** * * * ** ** ** * **gi109132849AGGGACAGCCCAGAGGA GTGGGGCCTGGGGCAGGAGGGAGGGACGAGGGGGAGGAAAGGGGCGAGCGgi108773792 GTGGGGCC-AGGGTGGGAGGGAGGGACAAGGGGGAGGAAAGGGGCGAGCAgi194680256 ATGGGCCCCCTGCACCCCCAGTCTCAGCGCCATTCCACATTCCTGGTCIt would be anticipated that increased DHFR reduces MTXcytotoxicity in normal cells while conferring apology in targetcells.A comparison of the human and mouse DHFR 39-UTR sequencesrevealed that only 100 nucleotides downstream from theterminator codon were conserved between the two species (18). legion(predicate)studies have focused on the effects of coding region variantson P-gp expression and function, whereas few noncodingregion variants have been investigated.Mechanisms that alter mRNA levels can change mRNA expressionand potentially G6PD activity. Recent evidence has demonstratethat the 3UTR of mRNA is an important regulatory site controllinginteractions with mRNA degradation machinery (Hollams et al., 2002Tourriere et al., 2002 Mangus et al., 2003 Wilkie e t al., 2003).3UTR RNA-binding proteins that recognize specific mRNA sequenceelements and secondary structure ordain the fate of mRNAtranscripts. Polymorphisms in the 3UTR of G6PD could disruptRNA-protein interactions, resulting in altered mRNA stability. The stability of mRNA may be altered by 3UTR polymorphisms if actualisation of specific mRNA sequence and secondary structure by regulatory proteins is disrupted (Shen et al., 1999 Hollams et al.,2002 Tourriere et al., 2002). A polymorphism in the 3UTR ofhuman tumor chagrin factor-_ changes binding affinity for a multiproteincomplex that contains the HuR regulatory protein (Di Marcoet al., 2001). HuR binds AG-rich elements in the 3UTR of definitegenes (Peng et al., 1998) and has been shown to stabilize mRNAcontaining tumor necrosis factor-_ 3_-UTR sequence motifs (Dean etal., 2001). There is one report that the 3435C_T synonymous variantdecreases mRNA stability (Wang et al., 2005), but to our knowledgeno pharmacogenetic research of this type has been conducted forABCB1 3_-UTR variants. Thus, our mRNA half-life data defendnovel findings as to the effects the _89A_T, _146G_A, and_193A_G polymorphisms have on ABCB1 mRNA stability anddemonstrate the utility of using stable cell lines made with Flp-In engineering science for these measurements. Similarly